EMAIL THIS PAGE TO A FRIEND

IDH1

isocitrate dehydrogenase 1 (NADP+), soluble

125 Gene Product Result for
Synonyms: IDCD IDH IDP IDPC PICD
UniProtKB ID: O75874, Q7Z3V0, Q93090, Q9NTJ9, Q9UKW8
Gene ID:
Human(3417) Summary: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. [provided by RefSeq, Jul 2008]
Mouse(15926) isocitrate dehydrogenase 1 (NADP+), soluble
Rat(24479) isocitrate dehydrogenase 1 (NADP+), soluble
Zebrafish(100006589) isocitrate dehydrogenase 1 (NADP+), soluble
chicken(424112) isocitrate dehydrogenase 1 (NADP+), soluble
dog(478889) isocitrate dehydrogenase 1 (NADP+), soluble
domestic cat(751618) isocitrate dehydrogenase 1 (NADP+), soluble
cow(281235) isocitrate dehydrogenase 1 (NADP+), soluble
Horse(100066416) isocitrate dehydrogenase 1 (NADP+), soluble
Thale Cress(829679) Isocitrate dehydrogenase [NAD] regulatory subunit 1
sheep(443257) isocitrate dehydrogenase 1 (NADP+), soluble
Domestic Rabbit(100328559) isocitrate dehydrogenase 1 (NADP+), soluble
domestic guinea pig(100729107) isocitrate dehydrogenase 1 (NADP+), soluble
naked mole-rat(101705662) isocitrate dehydrogenase 1 (NADP+), soluble
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100102 Anti-IDH1 (336-350) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100101 Anti-IDH1 (41-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2101123 Anti-IDH1 (ab1) antibody produced in rabbit affinity isolated antibody mouse, rabbit, sheep, human, bovine, rabbit, rat, horse, guinea pig
immunohistochemistry, western blot pricing
SAB2101124 Anti-IDH1 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, mouse, sheep, rat, rabbit, human
immunohistochemistry, western blot pricing
SAB4200522 Anti-IDH1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200548 Anti-IDH1 (R132H) antibody, Mouse monoclonal clone HMab-1, purified from hybridoma cell culture human
western blot pricing
SAB2501422 Anti-IDH1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, western blot pricing
SAB2501423 Anti-IDH1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rabbit, human, canine, rat
ELISA, western blot pricing
SAB2701644 Anti-idh1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2701749 Anti-idh1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB4200592 Anti-IDH1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human
immunofluorescence, immunoprecipitation (IP), western blot pricing
HPA035248 Anti-IDH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunohistochemistry, western blot pricing
SAB3500511 Anti-IDH1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
HPA057936 Anti-IDH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4200547 Monoclonal Anti-IDH1 (R132S) antibody produced in mouse ~1.0 mg/mL, clone SMab-1, purified immunoglobulin human
western blot pricing
SAB4100064 Monoclonal Anti-IDH1 antibody produced in mouse clone IDH1-A36, culture supernatant human
western blot pricing
AMAB90578 Monoclonal Anti-IDH1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0219, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK062 IDH Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABE454 Anti-IDH Antibody Anti-IDH Antibody is a highly specific rabbit polyclonal antibody, that targets IDH1 & has been tested in western blotting & IHC (Paraffin). pricing
MABC1103 Anti-IDH1/2 Mutant (R132/172) Antibody, clone MsMab-1 This Anti-IDH1/2 Mutant (R132/172) Antibody, clone MsMab-1 is validated for use in Western Blotting, Immunohistochemistry (Paraffin) for the detection of IDH1/2 Mutant (R132/172). pricing
MABC141 Anti-IDH1 Antibody, clone 12D6.1 This Anti-IDH1 Antibody, clone 12D6.1 is validated for use in Western Blotting, Immunohistochemistry (Paraffin) for the detection of IDH1. pricing
MABC197 Anti-Isocitrate Dehydrogenase 1 - IDH1 Antibody, clone RMab-3 Detect the IDH1 protein using this Anti-Isocitrate Dehydrogenase 1 (IDH1), clone RMab-3 validated for use in WB. pricing
MABC171 Anti-Isocitrate Dehydrogenase 1 (IDH1)-R132H Antibody, clone HMab-1 Detect Isocitrate Dehydrogenase 1 (IDH1)-R132H using this Anti-Isocitrate Dehydrogenase 1 (IDH1)-R132H Antibody, clone HMab-1 validated for use in Western Blotting, IHC, ICC. pricing
MABC187 Anti-Isocitrate Dehydrogenase 1 (IDH1)-R132S Antibody, clone SMab-1 Anti-Isocitrate Dehydrogenase 1 (IDH1)-R132S Antibody, clone SMab-1 is an antibody against Isocitrate Dehydrogenase 1 (IDH1)-R132S for use in Western Blotting, ICC & IHC. pricing
MABC170 Anti-Isocitrate dehydrogenase - IDH1 Antibody, clone r41/W09 Detect the IDH1 protein using this Anti-Isocitrate dehydrogenase (IDH1), clone r41/W09 validated for use in WB & IHC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005896 Rosetta Predictions human pricing
NM_031510 Rosetta Predictions rat pricing
NM_001111320 Rosetta Predictions mouse pricing
NM_010497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340497 predicted 1166
2 SASI_Hs01_00023490 predicted 833
3 SASI_Hs01_00023491 predicted 770
4 SASI_Hs01_00023492 predicted 725
5 SASI_Hs01_00023493 predicted 499
6 SASI_Hs01_00023495 predicted 1450
7 SASI_Hs01_00023497 predicted 878
8 SASI_Hs02_00340498 predicted 613
9 SASI_Hs01_00023498 predicted 351
10 SASI_Hs01_00023499 predicted 272
11 SASI_Hs01_00023494 predicted 292
12 SASI_Hs01_00023496 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073156 predicted 1304
2 SASI_Rn01_00073157 predicted 573
3 SASI_Rn01_00073158 predicted 521
4 SASI_Rn01_00073159 predicted 1174
5 SASI_Rn01_00073161 predicted 967
6 SASI_Rn01_00073162 predicted 904
7 SASI_Rn02_00264634 predicted 1099
8 SASI_Rn01_00073163 predicted 760
9 SASI_Rn01_00073164 predicted 746
10 SASI_Rn01_00073165 predicted 664
11 SASI_Rn01_00073160 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306822 predicted 432
2 SASI_Mm02_00306823 predicted 642
3 SASI_Mm02_00306824 predicted 839
4 SASI_Mm02_00306825 predicted 1035
5 SASI_Mm02_00306826 predicted 728
6 SASI_Mm02_00306827 predicted 595
7 SASI_Mm02_00306828 predicted 908
8 SASI_Mm02_00306829 predicted 1133
9 SASI_Mm02_00306830 predicted 466
10 SASI_Mm02_00306831 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318749 predicted 411
2 SASI_Mm02_00318750 predicted 623
3 SASI_Mm01_00092556 predicted 818
4 SASI_Mm01_00092557 predicted 1014
5 SASI_Mm02_00318751 predicted 706
6 SASI_Mm01_00092559 predicted 573
7 SASI_Mm01_00092560 predicted 888
8 SASI_Mm01_00092563 predicted 1113
9 SASI_Mm02_00318752 predicted 452
10 SASI_Mm02_00318753 predicted 804
11 SASI_Mm01_00092558 predicted 849
12 SASI_Mm01_00092561 predicted 647
13 SASI_Mm01_00092562 predicted 878
14 SASI_Mm01_00092564 predicted 557
15 SASI_Mm01_00092565 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005896
IDH1 MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 1 (NADP+), soluble
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-1363s1c1
Sequence:CCGGGCTGCTTGCATTAAAGGTTTACTCGAGTAAACCTTTAATGCAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-613s1c1
Sequence:CCGGCCTATCATCATAGGTCGTCATCTCGAGATGACGACCTATGATGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-292s1c1
Sequence:CCGGCGAATCATTTGGGAATTGATTCTCGAGAATCAATTCCCAAATGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-1306s1c1
Sequence:CCGGGCTTTGGAAGAAGTCTCTATTCTCGAGAATAGAGACTTCTTCCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-850s1c1
Sequence:CCGGCCTTTGTATCTGAGCACCAAACTCGAGTTTGGTGCTCAGATACAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-1363s21c1
Sequence:CCGGGCTGCTTGCATTAAAGGTTTACTCGAGTAAACCTTTAATGCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-850s21c1
Sequence:CCGGCCTTTGTATCTGAGCACCAAACTCGAGTTTGGTGCTCAGATACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-292s21c1
Sequence:CCGGCGAATCATTTGGGAATTGATTCTCGAGAATCAATTCCCAAATGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-1306s21c1
Sequence:CCGGGCTTTGGAAGAAGTCTCTATTCTCGAGAATAGAGACTTCTTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005896
IDH1 MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 1 (NADP+), soluble
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-1363s1c1
Sequence:CCGGGCTGCTTGCATTAAAGGTTTACTCGAGTAAACCTTTAATGCAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-613s1c1
Sequence:CCGGCCTATCATCATAGGTCGTCATCTCGAGATGACGACCTATGATGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-292s1c1
Sequence:CCGGCGAATCATTTGGGAATTGATTCTCGAGAATCAATTCCCAAATGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-1306s1c1
Sequence:CCGGGCTTTGGAAGAAGTCTCTATTCTCGAGAATAGAGACTTCTTCCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-850s1c1
Sequence:CCGGCCTTTGTATCTGAGCACCAAACTCGAGTTTGGTGCTCAGATACAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-1363s21c1
Sequence:CCGGGCTGCTTGCATTAAAGGTTTACTCGAGTAAACCTTTAATGCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-850s21c1
Sequence:CCGGCCTTTGTATCTGAGCACCAAACTCGAGTTTGGTGCTCAGATACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-292s21c1
Sequence:CCGGCGAATCATTTGGGAATTGATTCTCGAGAATCAATTCCCAAATGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-1306s21c1
Sequence:CCGGGCTTTGGAAGAAGTCTCTATTCTCGAGAATAGAGACTTCTTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005896
IDH1 MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 1 (NADP+), soluble
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-1363s1c1
Sequence:CCGGGCTGCTTGCATTAAAGGTTTACTCGAGTAAACCTTTAATGCAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-613s1c1
Sequence:CCGGCCTATCATCATAGGTCGTCATCTCGAGATGACGACCTATGATGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-292s1c1
Sequence:CCGGCGAATCATTTGGGAATTGATTCTCGAGAATCAATTCCCAAATGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-1306s1c1
Sequence:CCGGGCTTTGGAAGAAGTCTCTATTCTCGAGAATAGAGACTTCTTCCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005896.2-850s1c1
Sequence:CCGGCCTTTGTATCTGAGCACCAAACTCGAGTTTGGTGCTCAGATACAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-1363s21c1
Sequence:CCGGGCTGCTTGCATTAAAGGTTTACTCGAGTAAACCTTTAATGCAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-850s21c1
Sequence:CCGGCCTTTGTATCTGAGCACCAAACTCGAGTTTGGTGCTCAGATACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-292s21c1
Sequence:CCGGCGAATCATTTGGGAATTGATTCTCGAGAATCAATTCCCAAATGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005896.2-1306s21c1
Sequence:CCGGGCTTTGGAAGAAGTCTCTATTCTCGAGAATAGAGACTTCTTCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010497
VALIDATED
IDH1 MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 1 (NADP+), soluble
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010497.1-1272s1c1
Sequence:CCGGCCTGGGCTTAGAATGAGTCTTCTCGAGAAGACTCATTCTAAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010497.1-729s1c1
Sequence:CCGGCCCAGTTTGAAGCTCAGAATACTCGAGTATTCTGAGCTTCAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010497.1-1148s1c1
Sequence:CCGGGCTGCTTGCATTAAAGGCTTACTCGAGTAAGCCTTTAATGCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010497.1-1238s1c1
Sequence:CCGGGCCAAATTAGCTCAGGCCAAACTCGAGTTTGGCCTGAGCTAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010497.1-740s1c1
Sequence:CCGGGCTCAGAATATCTGCTATGAACTCGAGTTCATAGCAGATATTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-488s21c1
Sequence:CCGGGTCTTCAGGGAAGCTATTATCCTCGAGGATAATAGCTTCCCTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010497.3-1298s21c1
Sequence:CCGGGCTGCTTGCATTAAAGGCTTACTCGAGTAAGCCTTTAATGCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010497.3-1422s21c1
Sequence:CCGGCCTGGGCTTAGAATGAGTCTTCTCGAGAAGACTCATTCTAAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-1393s21c1
Sequence:CCGGATTAGCTCAGGCCAAACTTTACTCGAGTAAAGTTTGGCCTGAGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-280s21c1
Sequence:CCGGGGATCTGCATAGCTATGATTTCTCGAGAAATCATAGCTATGCAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-580s21c1
Sequence:CCGGCCAATACAGAGCAACTGATTTCTCGAGAAATCAGTTGCTCTGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-716s21c1
Sequence:CCGGTACAACCAGGATAAGTCAATTCTCGAGAATTGACTTATCCTGGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010497
VALIDATED
IDH1 MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 1 (NADP+), soluble
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010497.1-1272s1c1
Sequence:CCGGCCTGGGCTTAGAATGAGTCTTCTCGAGAAGACTCATTCTAAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010497.1-729s1c1
Sequence:CCGGCCCAGTTTGAAGCTCAGAATACTCGAGTATTCTGAGCTTCAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010497.1-1148s1c1
Sequence:CCGGGCTGCTTGCATTAAAGGCTTACTCGAGTAAGCCTTTAATGCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010497.1-1238s1c1
Sequence:CCGGGCCAAATTAGCTCAGGCCAAACTCGAGTTTGGCCTGAGCTAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010497.1-740s1c1
Sequence:CCGGGCTCAGAATATCTGCTATGAACTCGAGTTCATAGCAGATATTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-488s21c1
Sequence:CCGGGTCTTCAGGGAAGCTATTATCCTCGAGGATAATAGCTTCCCTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010497.3-1298s21c1
Sequence:CCGGGCTGCTTGCATTAAAGGCTTACTCGAGTAAGCCTTTAATGCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010497.3-1422s21c1
Sequence:CCGGCCTGGGCTTAGAATGAGTCTTCTCGAGAAGACTCATTCTAAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-1393s21c1
Sequence:CCGGATTAGCTCAGGCCAAACTTTACTCGAGTAAAGTTTGGCCTGAGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-280s21c1
Sequence:CCGGGGATCTGCATAGCTATGATTTCTCGAGAAATCATAGCTATGCAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-580s21c1
Sequence:CCGGCCAATACAGAGCAACTGATTTCTCGAGAAATCAGTTGCTCTGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-716s21c1
Sequence:CCGGTACAACCAGGATAAGTCAATTCTCGAGAATTGACTTATCCTGGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010497
VALIDATED
IDH1 MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 1 (NADP+), soluble
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010497.1-1272s1c1
Sequence:CCGGCCTGGGCTTAGAATGAGTCTTCTCGAGAAGACTCATTCTAAGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010497.1-729s1c1
Sequence:CCGGCCCAGTTTGAAGCTCAGAATACTCGAGTATTCTGAGCTTCAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010497.1-1148s1c1
Sequence:CCGGGCTGCTTGCATTAAAGGCTTACTCGAGTAAGCCTTTAATGCAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010497.1-1238s1c1
Sequence:CCGGGCCAAATTAGCTCAGGCCAAACTCGAGTTTGGCCTGAGCTAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010497.1-740s1c1
Sequence:CCGGGCTCAGAATATCTGCTATGAACTCGAGTTCATAGCAGATATTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-488s21c1
Sequence:CCGGGTCTTCAGGGAAGCTATTATCCTCGAGGATAATAGCTTCCCTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010497.3-1298s21c1
Sequence:CCGGGCTGCTTGCATTAAAGGCTTACTCGAGTAAGCCTTTAATGCAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010497.3-1422s21c1
Sequence:CCGGCCTGGGCTTAGAATGAGTCTTCTCGAGAAGACTCATTCTAAGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-1393s21c1
Sequence:CCGGATTAGCTCAGGCCAAACTTTACTCGAGTAAAGTTTGGCCTGAGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-280s21c1
Sequence:CCGGGGATCTGCATAGCTATGATTTCTCGAGAAATCATAGCTATGCAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-580s21c1
Sequence:CCGGCCAATACAGAGCAACTGATTTCTCGAGAAATCAGTTGCTCTGTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010497.3-716s21c1
Sequence:CCGGTACAACCAGGATAAGTCAATTCTCGAGAATTGACTTATCCTGGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)