EMAIL THIS PAGE TO A FRIEND

IDH2

isocitrate dehydrogenase 2 (NADP+), mitochondrial

71 Gene Product Result for
Synonyms: D2HGA2 ICD-M IDH IDHM IDP IDPM mNADP-IDH
UniProtKB ID: P48735, B2R6L6, Q96GT3
Gene ID:
Human(3418) Summary: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. [provided by RefSeq, Jul 2008]
Mouse(269951) isocitrate dehydrogenase 2 (NADP+), mitochondrial
Rat(361596) isocitrate dehydrogenase 2 (NADP+), mitochondrial
Zebrafish(386951) isocitrate dehydrogenase 2 (NADP+), mitochondrial
cow(327669) isocitrate dehydrogenase 2 (NADP+), mitochondrial
domestic cat(101082315) isocitrate dehydrogenase 2 (NADP+), mitochondrial
dog(479043) isocitrate dehydrogenase 2 (NADP+), mitochondrial
chicken(431056) isocitrate dehydrogenase 2 (NADP+), mitochondrial
Thale Cress(816218) Isocitrate dehydrogenase [NAD] regulatory subunit 2
domestic guinea pig(100726681) isocitrate dehydrogenase 2 (NADP+), mitochondrial
naked mole-rat(101708667) isocitrate dehydrogenase 2 (NADP+), mitochondrial
sheep(101102843) isocitrate dehydrogenase 2 (NADP+), mitochondrial
Domestic Rabbit(100340796) isocitrate dehydrogenase 2 (NADP+), mitochondrial
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK062 IDH Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002168 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002168 Rosetta Predictions human pricing
NM_001014161 Rosetta Predictions rat pricing
NM_173011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151612 predicted 242
2 SASI_Hs02_00333382 predicted 973
3 SASI_Hs01_00151613 predicted 930
4 SASI_Hs01_00151614 predicted 846
5 SASI_Hs01_00151615 predicted 756
6 SASI_Hs02_00333383 predicted 877
7 SASI_Hs01_00151616 predicted 486
8 SASI_Hs01_00151617 predicted 301
9 SASI_Hs01_00151618 predicted 1086
10 SASI_Hs01_00151619 predicted 1099
11 SASI_Hs01_00151620 predicted 346
12 SASI_Hs01_00151621 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093144 predicted 555
2 SASI_Rn01_00093145 predicted 978
3 SASI_Rn01_00093146 predicted 879
4 SASI_Rn01_00093147 predicted 349
5 SASI_Rn01_00093148 predicted 585
6 SASI_Rn01_00093149 predicted 429
7 SASI_Rn01_00093150 predicted 768
8 SASI_Rn01_00093151 predicted 346
9 SASI_Rn01_00093152 predicted 853
10 SASI_Rn02_00201648 predicted 1240
11 SASI_Rn01_00093143 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345057 predicted 571
2 SASI_Mm02_00345058 predicted 863
3 SASI_Mm02_00345059 predicted 390
4 SASI_Mm02_00345060 predicted 205
5 SASI_Mm02_00345061 predicted 267
6 SASI_Mm02_00345062 predicted 950
7 SASI_Mm02_00345063 predicted 368
8 SASI_Mm02_00345064 predicted 1359
9 SASI_Mm02_00345065 predicted 223
10 SASI_Mm02_00345066 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173011
VALIDATED
IDH2 MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 2 (NADP+), mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-686s21c1
Sequence:CCGGCAAGGAGTGGGAGGTGTATAACTCGAGTTATACACCTCCCACTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173011.2-1449s21c1
Sequence:CCGGAGCTCCAGTGGGTACTCTGTACTCGAGTACAGAGTACCCACTGGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-740s21c1
Sequence:CCGGCAACACCGACGAGTCCATTTCCTCGAGGAAATGGACTCGTCGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-1230s21c1
Sequence:CCGGGATGGGAACCAGGACCTTATCCTCGAGGATAAGGTCCTGGTTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-879s21c1
Sequence:CCGGATCTTTGACAAGCACTATAAGCTCGAGCTTATAGTGCTTGTCAAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-267s1c1
Sequence:CCGGCGTGGATGTTCAGCTCAAGTACTCGAGTACTTGAGCTGAACATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173011.1-1474s1c1
Sequence:CCGGGTGGCCTTTCTAGGGACATTTCTCGAGAAATGTCCCTAGAAAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-1308s1c1
Sequence:CCGGCCTCAGCAATGTGAAGCTGAACTCGAGTTCAGCTTCACATTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-780s1c1
Sequence:CCGGGCTCTACTTGAGCACCAAGAACTCGAGTTCTTGGTGCTCAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173011.1-415s1c1
Sequence:CCGGGAAGAGTTCAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173011
VALIDATED
IDH2 MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 2 (NADP+), mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-686s21c1
Sequence:CCGGCAAGGAGTGGGAGGTGTATAACTCGAGTTATACACCTCCCACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173011.2-1449s21c1
Sequence:CCGGAGCTCCAGTGGGTACTCTGTACTCGAGTACAGAGTACCCACTGGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-740s21c1
Sequence:CCGGCAACACCGACGAGTCCATTTCCTCGAGGAAATGGACTCGTCGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-1230s21c1
Sequence:CCGGGATGGGAACCAGGACCTTATCCTCGAGGATAAGGTCCTGGTTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-879s21c1
Sequence:CCGGATCTTTGACAAGCACTATAAGCTCGAGCTTATAGTGCTTGTCAAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-267s1c1
Sequence:CCGGCGTGGATGTTCAGCTCAAGTACTCGAGTACTTGAGCTGAACATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173011.1-1474s1c1
Sequence:CCGGGTGGCCTTTCTAGGGACATTTCTCGAGAAATGTCCCTAGAAAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-1308s1c1
Sequence:CCGGCCTCAGCAATGTGAAGCTGAACTCGAGTTCAGCTTCACATTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-780s1c1
Sequence:CCGGGCTCTACTTGAGCACCAAGAACTCGAGTTCTTGGTGCTCAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173011.1-415s1c1
Sequence:CCGGGAAGAGTTCAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173011
VALIDATED
IDH2 MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 2 (NADP+), mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-686s21c1
Sequence:CCGGCAAGGAGTGGGAGGTGTATAACTCGAGTTATACACCTCCCACTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173011.2-1449s21c1
Sequence:CCGGAGCTCCAGTGGGTACTCTGTACTCGAGTACAGAGTACCCACTGGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-740s21c1
Sequence:CCGGCAACACCGACGAGTCCATTTCCTCGAGGAAATGGACTCGTCGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-1230s21c1
Sequence:CCGGGATGGGAACCAGGACCTTATCCTCGAGGATAAGGTCCTGGTTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173011.2-879s21c1
Sequence:CCGGATCTTTGACAAGCACTATAAGCTCGAGCTTATAGTGCTTGTCAAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-267s1c1
Sequence:CCGGCGTGGATGTTCAGCTCAAGTACTCGAGTACTTGAGCTGAACATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173011.1-1474s1c1
Sequence:CCGGGTGGCCTTTCTAGGGACATTTCTCGAGAAATGTCCCTAGAAAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-1308s1c1
Sequence:CCGGCCTCAGCAATGTGAAGCTGAACTCGAGTTCAGCTTCACATTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173011.1-780s1c1
Sequence:CCGGGCTCTACTTGAGCACCAAGAACTCGAGTTCTTGGTGCTCAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173011.1-415s1c1
Sequence:CCGGGAAGAGTTCAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002168
VALIDATED
IDH2 MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 2 (NADP+), mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002168.2-891s21c1
Sequence:GTACCGGATCTTTGACAAGCACTATAAGCTCGAGCTTATAGTGCTTGTCAAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-251s21c1
Sequence:CCGGTGATGAGATGACCCGTATTATCTCGAGATAATACGGGTCATCTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002168.2-1534s21c1
Sequence:CCGGCCTCTCTGGAGGCCTTTCTAGCTCGAGCTAGAAAGGCCTCCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-835s21c1
Sequence:CCGGCCAAGAACACCATACTGAAAGCTCGAGCTTTCAGTATGGTGTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-263s1c1
Sequence:CCGGCCGTATTATCTGGCAGTTCATCTCGAGATGAACTGCCAGATAATACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-305s21c1
Sequence:CCGGCCACGTGGACATCCAGCTAAACTCGAGTTTAGCTGGATGTCCACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002168.2-821s1c1
Sequence:CCGGGCTGTACATGAGCACCAAGAACTCGAGTTCTTGGTGCTCATGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-914s1c1
Sequence:CCGGCGACTTCGACAAGAATAAGATCTCGAGATCTTATTCTTGTCGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002168.2-1008s1c1
Sequence:CCGGTGCAAGAACTATGACGGAGATCTCGAGATCTCCGTCATAGTTCTTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-309s1c1
Sequence:CCGGGTGGACATCCAGCTAAAGTATCTCGAGATACTTTAGCTGGATGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002168
VALIDATED
IDH2 MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 2 (NADP+), mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002168.2-891s21c1
Sequence:GTACCGGATCTTTGACAAGCACTATAAGCTCGAGCTTATAGTGCTTGTCAAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-251s21c1
Sequence:CCGGTGATGAGATGACCCGTATTATCTCGAGATAATACGGGTCATCTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002168.2-1534s21c1
Sequence:CCGGCCTCTCTGGAGGCCTTTCTAGCTCGAGCTAGAAAGGCCTCCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-835s21c1
Sequence:CCGGCCAAGAACACCATACTGAAAGCTCGAGCTTTCAGTATGGTGTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-263s1c1
Sequence:CCGGCCGTATTATCTGGCAGTTCATCTCGAGATGAACTGCCAGATAATACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-305s21c1
Sequence:CCGGCCACGTGGACATCCAGCTAAACTCGAGTTTAGCTGGATGTCCACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002168.2-821s1c1
Sequence:CCGGGCTGTACATGAGCACCAAGAACTCGAGTTCTTGGTGCTCATGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-914s1c1
Sequence:CCGGCGACTTCGACAAGAATAAGATCTCGAGATCTTATTCTTGTCGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002168.2-1008s1c1
Sequence:CCGGTGCAAGAACTATGACGGAGATCTCGAGATCTCCGTCATAGTTCTTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-309s1c1
Sequence:CCGGGTGGACATCCAGCTAAAGTATCTCGAGATACTTTAGCTGGATGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002168
VALIDATED
IDH2 MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 2 (NADP+), mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002168.2-891s21c1
Sequence:GTACCGGATCTTTGACAAGCACTATAAGCTCGAGCTTATAGTGCTTGTCAAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-251s21c1
Sequence:CCGGTGATGAGATGACCCGTATTATCTCGAGATAATACGGGTCATCTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002168.2-1534s21c1
Sequence:CCGGCCTCTCTGGAGGCCTTTCTAGCTCGAGCTAGAAAGGCCTCCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-835s21c1
Sequence:CCGGCCAAGAACACCATACTGAAAGCTCGAGCTTTCAGTATGGTGTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-263s1c1
Sequence:CCGGCCGTATTATCTGGCAGTTCATCTCGAGATGAACTGCCAGATAATACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002168.2-305s21c1
Sequence:CCGGCCACGTGGACATCCAGCTAAACTCGAGTTTAGCTGGATGTCCACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002168.2-821s1c1
Sequence:CCGGGCTGTACATGAGCACCAAGAACTCGAGTTCTTGGTGCTCATGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-914s1c1
Sequence:CCGGCGACTTCGACAAGAATAAGATCTCGAGATCTTATTCTTGTCGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002168.2-1008s1c1
Sequence:CCGGTGCAAGAACTATGACGGAGATCTCGAGATCTCCGTCATAGTTCTTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_002168.2-309s1c1
Sequence:CCGGGTGGACATCCAGCTAAAGTATCTCGAGATACTTTAGCTGGATGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)