EMAIL THIS PAGE TO A FRIEND

IDH3A

isocitrate dehydrogenase 3 (NAD+) alpha

97 Gene Product Result for
UniProtKB ID: P50213, D3DW83, Q9H3X0
Gene ID:
Human(3419) Summary: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the alpha subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. [provided by RefSeq, Jul 2008]
Mouse(67834) isocitrate dehydrogenase 3 (NAD+) alpha
Rat(114096) isocitrate dehydrogenase 3 (NAD+) alpha
sheep(101120868) isocitrate dehydrogenase 3 (NAD+) alpha
domestic guinea pig(100720114) isocitrate dehydrogenase 3 (NAD+) alpha
naked mole-rat(101706503) isocitrate dehydrogenase 3 (NAD+) alpha
Zebrafish(393926) isocitrate dehydrogenase 3 (NAD+) alpha
cow(282446) isocitrate dehydrogenase 3 (NAD+) alpha
domestic cat(101085721) isocitrate dehydrogenase 3 (NAD+) alpha
dog(479066) isocitrate dehydrogenase 3 (NAD+) alpha
chicken(415362) isocitrate dehydrogenase 3 (NAD+) alpha
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100032 Anti-IDH3A (336-349) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100033 Anti-IDH3A (352-366) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501692 Anti-IDH3A (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, bovine, human, mouse, canine, rat
ELISA, western blot pricing
SAB1405983 Anti-IDH3A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
immunofluorescence, western blot pricing
SAB2701643 Anti-idh3a antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701754 Anti-idh3a antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV42237 Anti-IDH3A antibody produced in rabbit IgG fraction of antiserum zebrafish, bovine, canine, rabbit, horse, mouse, guinea pig, rat, human
immunohistochemistry, western blot pricing
HPA041465 Anti-IDH3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA062971 Anti-IDH3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1305916 ANTI-ISOCITRATE DEHYDROGENASE (IDH3)(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4100035 Monoclonal Anti-IDH3A antibody produced in mouse culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005530 Rosetta Predictions human pricing
NM_053638 Rosetta Predictions rat pricing
NM_029573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339757 predicted 912
2 SASI_Hs02_00339758 predicted 953
3 SASI_Hs01_00206094 predicted 750
4 SASI_Hs01_00206095 predicted 705
5 SASI_Hs02_00339759 predicted 836
6 SASI_Hs02_00339760 predicted 758
7 SASI_Hs02_00339761 predicted 722
8 SASI_Hs01_00206099 predicted 909
9 SASI_Hs01_00206100 predicted 797
10 SASI_Hs01_00206101 predicted 729
11 SASI_Hs01_00206096 predicted 531
12 SASI_Hs01_00206097 predicted 275
13 SASI_Hs01_00206098 predicted 362
14 SASI_Hs01_00206102 predicted 306
15 SASI_Hs01_00206103 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266359 predicted 933
2 SASI_Rn01_00093871 predicted 751
3 SASI_Rn01_00093872 predicted 703
4 SASI_Rn01_00093873 predicted 513
5 SASI_Rn01_00093874 predicted 576
6 SASI_Rn01_00093875 predicted 333
7 SASI_Rn01_00093876 predicted 978
8 SASI_Rn01_00093877 predicted 462
9 SASI_Rn01_00093878 predicted 1117
10 SASI_Rn02_00266360 predicted 996
11 SASI_Rn01_00093869 predicted 310
12 SASI_Rn01_00093870 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048373 predicted 528
2 SASI_Mm02_00335522 predicted 735
3 SASI_Mm01_00048374 predicted 1087
4 SASI_Mm01_00048377 predicted 883
5 SASI_Mm02_00335523 predicted 860
6 SASI_Mm01_00048378 predicted 460
7 SASI_Mm01_00048379 predicted 767
8 SASI_Mm01_00048380 predicted 686
9 SASI_Mm01_00048381 predicted 339
10 SASI_Mm01_00048382 predicted 386
11 SASI_Mm01_00048375 predicted 289
12 SASI_Mm01_00048376 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005530
VALIDATED
IDH3A MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 3 (NAD+) alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-1079s1c1
Sequence:CCGGGCTCAGACTTCACAGAGGAAACTCGAGTTTCCTCTGTGAAGTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-342s1c1
Sequence:CCGGCGGTCACCCATCTATGAATTTCTCGAGAAATTCATAGATGGGTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005530.2-754s1c1
Sequence:CCGGCCTTCCCAATTTGATGTTCTTCTCGAGAAGAACATCAAATTGGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-127s1c1
Sequence:CCGGGTAACTTTAATTCCAGGAGATCTCGAGATCTCCTGGAATTAAAGTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-1342s21c1
Sequence:CCGGTTAAGTGTCTACCTGGTAAATCTCGAGATTTACCAGGTAGACACTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-134s21c1
Sequence:CCGGTAATTCCAGGAGATGGTATTGCTCGAGCAATACCATCTCCTGGAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-1079s21c1
Sequence:CCGGGCTCAGACTTCACAGAGGAAACTCGAGTTTCCTCTGTGAAGTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-191s21c1
Sequence:CCGGATGCTGCCAAAGCACCTATTCCTCGAGGAATAGGTGCTTTGGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-408s21c1
Sequence:CCGGTGTCTCTATCGAAGGCTATAACTCGAGTTATAGCCTTCGATAGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005530
VALIDATED
IDH3A MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 3 (NAD+) alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-1079s1c1
Sequence:CCGGGCTCAGACTTCACAGAGGAAACTCGAGTTTCCTCTGTGAAGTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-342s1c1
Sequence:CCGGCGGTCACCCATCTATGAATTTCTCGAGAAATTCATAGATGGGTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005530.2-754s1c1
Sequence:CCGGCCTTCCCAATTTGATGTTCTTCTCGAGAAGAACATCAAATTGGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-127s1c1
Sequence:CCGGGTAACTTTAATTCCAGGAGATCTCGAGATCTCCTGGAATTAAAGTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-1342s21c1
Sequence:CCGGTTAAGTGTCTACCTGGTAAATCTCGAGATTTACCAGGTAGACACTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-134s21c1
Sequence:CCGGTAATTCCAGGAGATGGTATTGCTCGAGCAATACCATCTCCTGGAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-1079s21c1
Sequence:CCGGGCTCAGACTTCACAGAGGAAACTCGAGTTTCCTCTGTGAAGTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-191s21c1
Sequence:CCGGATGCTGCCAAAGCACCTATTCCTCGAGGAATAGGTGCTTTGGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-408s21c1
Sequence:CCGGTGTCTCTATCGAAGGCTATAACTCGAGTTATAGCCTTCGATAGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005530
VALIDATED
IDH3A MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 3 (NAD+) alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-1079s1c1
Sequence:CCGGGCTCAGACTTCACAGAGGAAACTCGAGTTTCCTCTGTGAAGTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-342s1c1
Sequence:CCGGCGGTCACCCATCTATGAATTTCTCGAGAAATTCATAGATGGGTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005530.2-754s1c1
Sequence:CCGGCCTTCCCAATTTGATGTTCTTCTCGAGAAGAACATCAAATTGGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_005530.2-127s1c1
Sequence:CCGGGTAACTTTAATTCCAGGAGATCTCGAGATCTCCTGGAATTAAAGTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-1342s21c1
Sequence:CCGGTTAAGTGTCTACCTGGTAAATCTCGAGATTTACCAGGTAGACACTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-134s21c1
Sequence:CCGGTAATTCCAGGAGATGGTATTGCTCGAGCAATACCATCTCCTGGAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-1079s21c1
Sequence:CCGGGCTCAGACTTCACAGAGGAAACTCGAGTTTCCTCTGTGAAGTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-191s21c1
Sequence:CCGGATGCTGCCAAAGCACCTATTCCTCGAGGAATAGGTGCTTTGGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005530.2-408s21c1
Sequence:CCGGTGTCTCTATCGAAGGCTATAACTCGAGTTATAGCCTTCGATAGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029573
IDH3A MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 3 (NAD+) alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-662s1c1
Sequence:CCGGCGGAGAACTGTAAAGACATTACTCGAGTAATGTCTTTACAGTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-202s1c1
Sequence:CCGGCGCAATGTCACAGCAATTCAACTCGAGTTGAATTGCTGTGACATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-733s1c1
Sequence:CCGGCCATCCCAGTTTGATGTTCTTCTCGAGAAGAACATCAAACTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-324s1c1
Sequence:CCGGCCATCCATCTATGAATCTGTTCTCGAGAACAGATTCATAGATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-759s1c1
Sequence:CCGGGCCAAATTTATACGGAGACATCTCGAGATGTCTCCGTATAAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029573
IDH3A MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 3 (NAD+) alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-662s1c1
Sequence:CCGGCGGAGAACTGTAAAGACATTACTCGAGTAATGTCTTTACAGTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-202s1c1
Sequence:CCGGCGCAATGTCACAGCAATTCAACTCGAGTTGAATTGCTGTGACATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-733s1c1
Sequence:CCGGCCATCCCAGTTTGATGTTCTTCTCGAGAAGAACATCAAACTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-324s1c1
Sequence:CCGGCCATCCATCTATGAATCTGTTCTCGAGAACAGATTCATAGATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-759s1c1
Sequence:CCGGGCCAAATTTATACGGAGACATCTCGAGATGTCTCCGTATAAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029573
IDH3A MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 3 (NAD+) alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-662s1c1
Sequence:CCGGCGGAGAACTGTAAAGACATTACTCGAGTAATGTCTTTACAGTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-202s1c1
Sequence:CCGGCGCAATGTCACAGCAATTCAACTCGAGTTGAATTGCTGTGACATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-733s1c1
Sequence:CCGGCCATCCCAGTTTGATGTTCTTCTCGAGAAGAACATCAAACTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-324s1c1
Sequence:CCGGCCATCCATCTATGAATCTGTTCTCGAGAACAGATTCATAGATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029573.2-759s1c1
Sequence:CCGGGCCAAATTTATACGGAGACATCTCGAGATGTCTCCGTATAAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)