EMAIL THIS PAGE TO A FRIEND

IDH3B

isocitrate dehydrogenase 3 (NAD+) beta

77 Gene Product Result for
Synonyms: H-IDHB RP46
Gene ID:
Human(3420) Summary: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Three alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(170718) isocitrate dehydrogenase 3 (NAD+) beta
Rat(94173) isocitrate dehydrogenase 3 (NAD+) beta
Zebrafish(415247) isocitrate dehydrogenase 3 (NAD+) beta
chicken(426573) isocitrate dehydrogenase 3 (NAD+) beta
dog(477177) isocitrate dehydrogenase 3 (NAD+) beta
cow(613338) isocitrate dehydrogenase 3 (NAD+) beta
domestic cat(101099035) isocitrate dehydrogenase 3 (NAD+) beta
domestic guinea pig(100717400) isocitrate dehydrogenase 3 (NAD+) beta
naked mole-rat(101709094) isocitrate dehydrogenase 3 (NAD+) beta
sheep(101104080) isocitrate dehydrogenase 3 (NAD+) beta
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK062 IDH Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174856 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074431 MISSION® esiRNA esiRNA targeting mouse Idh3b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006899 Rosetta Predictions human pricing
NM_174855 Rosetta Predictions human pricing
NM_174856 Rosetta Predictions human pricing
NM_053581 Rosetta Predictions rat pricing
NM_130884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246871 predicted 807
2 SASI_Hs01_00246873 predicted 253
3 SASI_Hs01_00246875 predicted 778
4 SASI_Hs01_00246876 predicted 782
5 SASI_Hs01_00246877 predicted 792
6 SASI_Hs01_00246878 predicted 778
7 SASI_Hs01_00246879 predicted 823
8 SASI_Hs01_00246872 predicted 252
9 SASI_Hs01_00246874 predicted 309
10 SASI_Hs02_00342576 predicted 737
11 SASI_Hs01_00246880 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043919 predicted 804
2 SASI_Hs01_00043921 predicted 250
3 SASI_Hs01_00043923 predicted 774
4 SASI_Hs01_00043924 predicted 779
5 SASI_Hs01_00043925 predicted 801
6 SASI_Hs01_00043926 predicted 779
7 SASI_Hs01_00043927 predicted 826
8 SASI_Hs01_00043920 predicted 254
9 SASI_Hs01_00043922 predicted 309
10 SASI_Hs02_00368743 predicted 739
11 SASI_Hs01_00043928 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179570 predicted 910
2 SASI_Hs01_00179571 predicted 904
3 SASI_Hs01_00179572 predicted 920
4 SASI_Hs01_00179573 predicted 846
5 SASI_Hs01_00179574 predicted 931
6 SASI_Hs01_00179575 predicted 900
7 SASI_Hs01_00179576 predicted 876
8 SASI_Hs01_00179577 predicted 923
9 SASI_Hs01_00179578 predicted 838
10 SASI_Hs01_00179579 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037166 predicted 201
2 SASI_Rn01_00037167 predicted 806
3 SASI_Rn01_00037168 predicted 1235
4 SASI_Rn01_00037169 predicted 613
5 SASI_Rn01_00037170 predicted 259
6 SASI_Rn01_00037171 predicted 452
7 SASI_Rn01_00037172 predicted 1186
8 SASI_Rn01_00037173 predicted 791
9 SASI_Rn01_00037174 predicted 257
10 SASI_Rn01_00037175 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338315 predicted 198
2 SASI_Mm01_00068103 predicted 1213
3 SASI_Mm01_00068104 predicted 340
4 SASI_Mm01_00068105 predicted 805
5 SASI_Mm01_00068106 predicted 375
6 SASI_Mm01_00068107 predicted 418
7 SASI_Mm01_00068108 predicted 1033
8 SASI_Mm01_00068109 predicted 1245
9 SASI_Mm01_00068110 predicted 629
10 SASI_Mm01_00068111 predicted 1256
11 SASI_Mm01_00068112 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130884
VALIDATED
IDH3B MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 3 (NAD+) beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-349s21c1
Sequence:CCGGCATCATTGGAAAGATCTATACCTCGAGGTATAGATCTTTCCAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-1019s21c1
Sequence:CCGGCGGCATCTCAATCTTGAGTATCTCGAGATACTCAAGATTGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-1226s21c1
Sequence:CCGGCTTCAGTACAATGGACCAGAACTCGAGTTCTGGTCCATTGTACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-248s21c1
Sequence:CCGGCCTGTGGAATTTAAGGAGCATCTCGAGATGCTCCTTAAATTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-828s21c1
Sequence:CCGGCCAATCTCTATGGCAACATAACTCGAGTTATGTTGCCATAGAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-1227s1c1
Sequence:CCGGCTTCAGTACAATGGACCAGAACTCGAGTTCTGGTCCATTGTACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-249s1c1
Sequence:CCGGCCTGTGGAATTTAAGGAGCATCTCGAGATGCTCCTTAAATTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-372s1c1
Sequence:CCGGCCAATGGAGTATAAGGGTGAACTCGAGTTCACCCTTATACTCCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130884.1-665s1c1
Sequence:CCGGCGTCCATAAAGCCAACATCATCTCGAGATGATGTTGGCTTTATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-1020s1c1
Sequence:CCGGCGGCATCTCAATCTTGAGTATCTCGAGATACTCAAGATTGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130884
VALIDATED
IDH3B MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 3 (NAD+) beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-349s21c1
Sequence:CCGGCATCATTGGAAAGATCTATACCTCGAGGTATAGATCTTTCCAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-1019s21c1
Sequence:CCGGCGGCATCTCAATCTTGAGTATCTCGAGATACTCAAGATTGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-1226s21c1
Sequence:CCGGCTTCAGTACAATGGACCAGAACTCGAGTTCTGGTCCATTGTACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-248s21c1
Sequence:CCGGCCTGTGGAATTTAAGGAGCATCTCGAGATGCTCCTTAAATTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-828s21c1
Sequence:CCGGCCAATCTCTATGGCAACATAACTCGAGTTATGTTGCCATAGAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-1227s1c1
Sequence:CCGGCTTCAGTACAATGGACCAGAACTCGAGTTCTGGTCCATTGTACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-249s1c1
Sequence:CCGGCCTGTGGAATTTAAGGAGCATCTCGAGATGCTCCTTAAATTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-372s1c1
Sequence:CCGGCCAATGGAGTATAAGGGTGAACTCGAGTTCACCCTTATACTCCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130884.1-665s1c1
Sequence:CCGGCGTCCATAAAGCCAACATCATCTCGAGATGATGTTGGCTTTATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-1020s1c1
Sequence:CCGGCGGCATCTCAATCTTGAGTATCTCGAGATACTCAAGATTGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130884
VALIDATED
IDH3B MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 3 (NAD+) beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-349s21c1
Sequence:CCGGCATCATTGGAAAGATCTATACCTCGAGGTATAGATCTTTCCAATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-1019s21c1
Sequence:CCGGCGGCATCTCAATCTTGAGTATCTCGAGATACTCAAGATTGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-1226s21c1
Sequence:CCGGCTTCAGTACAATGGACCAGAACTCGAGTTCTGGTCCATTGTACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-248s21c1
Sequence:CCGGCCTGTGGAATTTAAGGAGCATCTCGAGATGCTCCTTAAATTCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130884.3-828s21c1
Sequence:CCGGCCAATCTCTATGGCAACATAACTCGAGTTATGTTGCCATAGAGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-1227s1c1
Sequence:CCGGCTTCAGTACAATGGACCAGAACTCGAGTTCTGGTCCATTGTACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-249s1c1
Sequence:CCGGCCTGTGGAATTTAAGGAGCATCTCGAGATGCTCCTTAAATTCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-372s1c1
Sequence:CCGGCCAATGGAGTATAAGGGTGAACTCGAGTTCACCCTTATACTCCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130884.1-665s1c1
Sequence:CCGGCGTCCATAAAGCCAACATCATCTCGAGATGATGTTGGCTTTATGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130884.1-1020s1c1
Sequence:CCGGCGGCATCTCAATCTTGAGTATCTCGAGATACTCAAGATTGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174856
VALIDATED
IDH3B MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 3 (NAD+) beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-924s21c1
Sequence:GTACCGGCCAATCTCTATGGGAACATTACTCGAGTAATGTTCCCATAGAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1471s21c1
Sequence:CCGGCCACATGGATGATGATGATTCCTCGAGGAATCATCATCATCCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1245s21c1
Sequence:CCGGTCGGTCACCTGCAGACTAAAGCTCGAGCTTTAGTCTGCAGGTGACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1158s21c1
Sequence:CCGGCGGTGAAGAAGGTGATCAAAGCTCGAGCTTTGATCACCTTCTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-888s21c1
Sequence:CCGGTGCAGAATCCTTACCAGTTTGCTCGAGCAAACTGGTAAGGATTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-896s1c1
Sequence:CCGGCCTTACCAGTTTGATGTGCTTCTCGAGAAGCACATCAAACTGGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-1225s1c1
Sequence:CCGGCGACTTCATCAAGTCTGTCATCTCGAGATGACAGACTTGATGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_174856.1-1157s1c1
Sequence:CCGGGCGGTGAAGAAGGTGATCAAACTCGAGTTTGATCACCTTCTTCACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-701s1c1
Sequence:CCGGCGGATTGCAAAGTTCGCCTTTCTCGAGAAAGGCGAACTTTGCAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-1115s1c1
Sequence:CCGGCGGCATCTTAATCTTGAGTATCTCGAGATACTCAAGATTAAGATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174856
VALIDATED
IDH3B MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 3 (NAD+) beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-924s21c1
Sequence:GTACCGGCCAATCTCTATGGGAACATTACTCGAGTAATGTTCCCATAGAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1471s21c1
Sequence:CCGGCCACATGGATGATGATGATTCCTCGAGGAATCATCATCATCCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1245s21c1
Sequence:CCGGTCGGTCACCTGCAGACTAAAGCTCGAGCTTTAGTCTGCAGGTGACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1158s21c1
Sequence:CCGGCGGTGAAGAAGGTGATCAAAGCTCGAGCTTTGATCACCTTCTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-888s21c1
Sequence:CCGGTGCAGAATCCTTACCAGTTTGCTCGAGCAAACTGGTAAGGATTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-896s1c1
Sequence:CCGGCCTTACCAGTTTGATGTGCTTCTCGAGAAGCACATCAAACTGGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-1225s1c1
Sequence:CCGGCGACTTCATCAAGTCTGTCATCTCGAGATGACAGACTTGATGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_174856.1-1157s1c1
Sequence:CCGGGCGGTGAAGAAGGTGATCAAACTCGAGTTTGATCACCTTCTTCACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-701s1c1
Sequence:CCGGCGGATTGCAAAGTTCGCCTTTCTCGAGAAAGGCGAACTTTGCAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-1115s1c1
Sequence:CCGGCGGCATCTTAATCTTGAGTATCTCGAGATACTCAAGATTAAGATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174856
VALIDATED
IDH3B MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 3 (NAD+) beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-924s21c1
Sequence:GTACCGGCCAATCTCTATGGGAACATTACTCGAGTAATGTTCCCATAGAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1471s21c1
Sequence:CCGGCCACATGGATGATGATGATTCCTCGAGGAATCATCATCATCCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1245s21c1
Sequence:CCGGTCGGTCACCTGCAGACTAAAGCTCGAGCTTTAGTCTGCAGGTGACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-1158s21c1
Sequence:CCGGCGGTGAAGAAGGTGATCAAAGCTCGAGCTTTGATCACCTTCTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_174856.1-888s21c1
Sequence:CCGGTGCAGAATCCTTACCAGTTTGCTCGAGCAAACTGGTAAGGATTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-896s1c1
Sequence:CCGGCCTTACCAGTTTGATGTGCTTCTCGAGAAGCACATCAAACTGGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-1225s1c1
Sequence:CCGGCGACTTCATCAAGTCTGTCATCTCGAGATGACAGACTTGATGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_174856.1-1157s1c1
Sequence:CCGGGCGGTGAAGAAGGTGATCAAACTCGAGTTTGATCACCTTCTTCACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-701s1c1
Sequence:CCGGCGGATTGCAAAGTTCGCCTTTCTCGAGAAAGGCGAACTTTGCAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174856.1-1115s1c1
Sequence:CCGGCGGCATCTTAATCTTGAGTATCTCGAGATACTCAAGATTAAGATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)