EMAIL THIS PAGE TO A FRIEND

IDH3G

isocitrate dehydrogenase 3 (NAD+) gamma

82 Gene Product Result for
Synonyms: H-IDHG
UniProtKB ID: P51553, E9PDD5, Q9BUU5
Gene ID:
Human(3421) Summary: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined. [provided by RefSeq, Jul 2008]
Mouse(15929) isocitrate dehydrogenase 3 (NAD+), gamma
Rat(25179) isocitrate dehydrogenase 3 (NAD), gamma
sheep(101110910) isocitrate dehydrogenase 3 (NAD+) gamma
Domestic Rabbit(100328743) isocitrate dehydrogenase 3 (NAD+) gamma
Zebrafish(550408) isocitrate dehydrogenase 3 (NAD+) gamma
cow(614145) isocitrate dehydrogenase 3 (NAD+) gamma
dog(481081) isocitrate dehydrogenase 3 (NAD+) gamma
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK062 IDH Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066701 MISSION® esiRNA esiRNA human IDH3G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004135 Rosetta Predictions human pricing
NM_174869 Rosetta Predictions human pricing
NM_031551 Rosetta Predictions rat pricing
NM_008323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036356 predicted 420
2 SASI_Hs01_00036357 predicted 671
3 SASI_Hs01_00036358 predicted 648
4 SASI_Hs01_00036359 predicted 711
5 SASI_Hs01_00036360 predicted 458
6 SASI_Hs01_00036361 predicted 808
7 SASI_Hs01_00036362 predicted 673
8 SASI_Hs01_00036363 predicted 604
9 SASI_Hs01_00036364 predicted 431
10 SASI_Hs01_00036365 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136300 predicted 422
2 SASI_Hs01_00136301 predicted 675
3 SASI_Hs01_00136302 predicted 646
4 SASI_Hs01_00136303 predicted 715
5 SASI_Hs01_00136304 predicted 450
6 SASI_Hs01_00136305 predicted 804
7 SASI_Hs02_00368746 predicted 666
8 SASI_Hs01_00136306 predicted 609
9 SASI_Hs01_00136307 predicted 424
10 SASI_Hs01_00136308 predicted 912
11 SASI_Hs01_00136309 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079504 predicted 1009
2 SASI_Rn01_00079506 predicted 1047
3 SASI_Rn01_00079507 predicted 387
4 SASI_Rn02_00264738 predicted 879
5 SASI_Rn01_00079509 predicted 947
6 SASI_Rn01_00079510 predicted 960
7 SASI_Rn01_00079511 predicted 283
8 SASI_Rn01_00079512 predicted 694
9 SASI_Rn01_00079513 predicted 975
10 SASI_Rn02_00264739 predicted 783
11 SASI_Rn01_00079505 predicted 318
12 SASI_Rn01_00079508 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130367 predicted 922
2 SASI_Mm01_00130370 predicted 865
3 SASI_Mm01_00130371 predicted 771
4 SASI_Mm01_00130373 predicted 944
5 SASI_Mm01_00130374 predicted 777
6 SASI_Mm01_00130375 predicted 676
7 SASI_Mm01_00130376 predicted 965
8 SASI_Mm02_00313642 predicted 380
9 SASI_Mm02_00313643 predicted 478
10 SASI_Mm02_00313644 predicted 250
11 SASI_Mm01_00130368 predicted 991
12 SASI_Mm01_00130369 predicted 250
13 SASI_Mm01_00130372 predicted 837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174869
VALIDATED
IDH3G MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 3 (NAD+) gamma
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174869.1-1137s1c1
Sequence:CCGGCGCCAATAAGAACATCGCCAACTCGAGTTGGCGATGTTCTTATTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-1125s1c1
Sequence:CCGGCGGCAAGAGTATCGCCAATAACTCGAGTTATTGGCGATACTCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-563s1c1
Sequence:CCGGCGTCGCACAAATCTCGAAACACTCGAGTGTTTCGAGATTTGTGCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174869.1-396s1c1
Sequence:CCGGGCTGCATGTCAAGTCCGTCTTCTCGAGAAGACGGACTTGACATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-534s1c1
Sequence:CCGGCAACATCGAAACCAACCATAACTCGAGTTATGGTTGGTTTCGATGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-1137s21c1
Sequence:CCGGCGCCAATAAGAACATCGCCAACTCGAGTTGGCGATGTTCTTATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-1125s21c1
Sequence:CCGGCGGCAAGAGTATCGCCAATAACTCGAGTTATTGGCGATACTCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-396s21c1
Sequence:CCGGGCTGCATGTCAAGTCCGTCTTCTCGAGAAGACGGACTTGACATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-534s21c1
Sequence:CCGGCAACATCGAAACCAACCATAACTCGAGTTATGGTTGGTTTCGATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174869
VALIDATED
IDH3G MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 3 (NAD+) gamma
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174869.1-1137s1c1
Sequence:CCGGCGCCAATAAGAACATCGCCAACTCGAGTTGGCGATGTTCTTATTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-1125s1c1
Sequence:CCGGCGGCAAGAGTATCGCCAATAACTCGAGTTATTGGCGATACTCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-563s1c1
Sequence:CCGGCGTCGCACAAATCTCGAAACACTCGAGTGTTTCGAGATTTGTGCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174869.1-396s1c1
Sequence:CCGGGCTGCATGTCAAGTCCGTCTTCTCGAGAAGACGGACTTGACATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-534s1c1
Sequence:CCGGCAACATCGAAACCAACCATAACTCGAGTTATGGTTGGTTTCGATGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-1137s21c1
Sequence:CCGGCGCCAATAAGAACATCGCCAACTCGAGTTGGCGATGTTCTTATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-1125s21c1
Sequence:CCGGCGGCAAGAGTATCGCCAATAACTCGAGTTATTGGCGATACTCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-396s21c1
Sequence:CCGGGCTGCATGTCAAGTCCGTCTTCTCGAGAAGACGGACTTGACATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-534s21c1
Sequence:CCGGCAACATCGAAACCAACCATAACTCGAGTTATGGTTGGTTTCGATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174869
VALIDATED
IDH3G MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 3 (NAD+) gamma
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174869.1-1137s1c1
Sequence:CCGGCGCCAATAAGAACATCGCCAACTCGAGTTGGCGATGTTCTTATTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-1125s1c1
Sequence:CCGGCGGCAAGAGTATCGCCAATAACTCGAGTTATTGGCGATACTCTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-563s1c1
Sequence:CCGGCGTCGCACAAATCTCGAAACACTCGAGTGTTTCGAGATTTGTGCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174869.1-396s1c1
Sequence:CCGGGCTGCATGTCAAGTCCGTCTTCTCGAGAAGACGGACTTGACATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174869.1-534s1c1
Sequence:CCGGCAACATCGAAACCAACCATAACTCGAGTTATGGTTGGTTTCGATGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-1137s21c1
Sequence:CCGGCGCCAATAAGAACATCGCCAACTCGAGTTGGCGATGTTCTTATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-1125s21c1
Sequence:CCGGCGGCAAGAGTATCGCCAATAACTCGAGTTATTGGCGATACTCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-396s21c1
Sequence:CCGGGCTGCATGTCAAGTCCGTCTTCTCGAGAAGACGGACTTGACATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174869.1-534s21c1
Sequence:CCGGCAACATCGAAACCAACCATAACTCGAGTTATGGTTGGTTTCGATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008323
VALIDATED
IDH3G MISSION shRNA Bacterial Glycerol Stock
isocitrate dehydrogenase 3 (NAD+) gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-1170s1c1
Sequence:CCGGCCAGGACATCATTCGTCATATCTCGAGATATGACGAATGATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-791s1c1
Sequence:CCGGGCATGATTGTAGACAACACAACTCGAGTTGTGTTGTCTACAATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-148s1c1
Sequence:CCGGCGAAGGAGCATTTCCTCACAACTCGAGTTGTGAGGAAATGCTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-859s1c1
Sequence:CCGGCCTAATCTCTATGGTAACATTCTCGAGAATGTTACCATAGAGATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-201s1c1
Sequence:CCGGGCGGCATACAGTGACTATGATCTCGAGATCATAGTCACTGTATGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-1170s21c1
Sequence:CCGGCCAGGACATCATTCGTCATATCTCGAGATATGACGAATGATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-859s21c1
Sequence:CCGGCCTAATCTCTATGGTAACATTCTCGAGAATGTTACCATAGAGATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-148s21c1
Sequence:CCGGCGAAGGAGCATTTCCTCACAACTCGAGTTGTGAGGAAATGCTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-791s21c1
Sequence:CCGGGCATGATTGTAGACAACACAACTCGAGTTGTGTTGTCTACAATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008323
VALIDATED
IDH3G MISSION shRNA shRNA Plasmid DNA
isocitrate dehydrogenase 3 (NAD+) gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-1170s1c1
Sequence:CCGGCCAGGACATCATTCGTCATATCTCGAGATATGACGAATGATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-791s1c1
Sequence:CCGGGCATGATTGTAGACAACACAACTCGAGTTGTGTTGTCTACAATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-148s1c1
Sequence:CCGGCGAAGGAGCATTTCCTCACAACTCGAGTTGTGAGGAAATGCTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-859s1c1
Sequence:CCGGCCTAATCTCTATGGTAACATTCTCGAGAATGTTACCATAGAGATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-201s1c1
Sequence:CCGGGCGGCATACAGTGACTATGATCTCGAGATCATAGTCACTGTATGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-1170s21c1
Sequence:CCGGCCAGGACATCATTCGTCATATCTCGAGATATGACGAATGATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-859s21c1
Sequence:CCGGCCTAATCTCTATGGTAACATTCTCGAGAATGTTACCATAGAGATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-148s21c1
Sequence:CCGGCGAAGGAGCATTTCCTCACAACTCGAGTTGTGAGGAAATGCTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-791s21c1
Sequence:CCGGGCATGATTGTAGACAACACAACTCGAGTTGTGTTGTCTACAATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008323
VALIDATED
IDH3G MISSION shRNA Lentiviral Transduction Particles
isocitrate dehydrogenase 3 (NAD+) gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-1170s1c1
Sequence:CCGGCCAGGACATCATTCGTCATATCTCGAGATATGACGAATGATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-791s1c1
Sequence:CCGGGCATGATTGTAGACAACACAACTCGAGTTGTGTTGTCTACAATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-148s1c1
Sequence:CCGGCGAAGGAGCATTTCCTCACAACTCGAGTTGTGAGGAAATGCTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-859s1c1
Sequence:CCGGCCTAATCTCTATGGTAACATTCTCGAGAATGTTACCATAGAGATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008323.1-201s1c1
Sequence:CCGGGCGGCATACAGTGACTATGATCTCGAGATCATAGTCACTGTATGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-1170s21c1
Sequence:CCGGCCAGGACATCATTCGTCATATCTCGAGATATGACGAATGATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-859s21c1
Sequence:CCGGCCTAATCTCTATGGTAACATTCTCGAGAATGTTACCATAGAGATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-148s21c1
Sequence:CCGGCGAAGGAGCATTTCCTCACAACTCGAGTTGTGAGGAAATGCTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008323.1-791s21c1
Sequence:CCGGGCATGATTGTAGACAACACAACTCGAGTTGTGTTGTCTACAATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)