EMAIL THIS PAGE TO A FRIEND

IDI2

isopentenyl-diphosphate delta isomerase 2

45 Gene Product Result for
Synonyms: IPPI2
UniProtKB ID: Q9BXS1
Gene ID:
Mouse(320581) isopentenyl-diphosphate delta isomerase 2
Rat(502143) isopentenyl-diphosphate delta isomerase 2
naked mole-rat(101702441) isopentenyl-diphosphate delta isomerase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033261 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033261 Rosetta Predictions human pricing
XM_577595 Rosetta Predictions rat pricing
NM_177197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126524 predicted 322
2 SASI_Hs01_00126525 predicted 971
3 SASI_Hs01_00126527 predicted 495
4 SASI_Hs01_00126528 predicted 854
5 SASI_Hs01_00126529 predicted 856
6 SASI_Hs01_00126530 predicted 797
7 SASI_Hs01_00126531 predicted 708
8 SASI_Hs01_00126532 predicted 844
9 SASI_Hs02_00361060 predicted 946
10 SASI_Hs01_00126533 predicted 314
11 SASI_Hs01_00126526 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406799 predicted 443
2 SASI_Rn02_00406800 predicted 259
3 SASI_Rn02_00406801 predicted 757
4 SASI_Rn02_00406802 predicted 451
5 SASI_Rn02_00406803 predicted 636
6 SASI_Rn02_00406804 predicted 488
7 SASI_Rn02_00406805 predicted 593
8 SASI_Rn02_00406806 predicted 504
9 SASI_Rn02_00406807 predicted 443
10 SASI_Rn02_00406808 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347210 predicted 319
2 SASI_Mm01_00020577 predicted 413
3 SASI_Mm01_00020578 predicted 717
4 SASI_Mm01_00020579 predicted 942
5 SASI_Mm01_00020580 predicted 301
6 SASI_Mm01_00020581 predicted 729
7 SASI_Mm01_00020582 predicted 748
8 SASI_Mm01_00020583 predicted 1033
9 SASI_Mm01_00020584 predicted 487
10 SASI_Mm01_00020585 predicted 717
11 SASI_Mm01_00020576 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177197
IDI2 MISSION shRNA Bacterial Glycerol Stock
isopentenyl-diphosphate delta isomerase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177197.2-1640s1c1
Sequence:CCGGGCCTCCTAGAACTGTGACAAACTCGAGTTTGTCACAGTTCTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-420s1c1
Sequence:CCGGCCAGATTTCCATAAAGGACATCTCGAGATGTCCTTTATGGAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-212s1c1
Sequence:CCGGGAGCCTTCAGTGTGGTCCTTTCTCGAGAAAGGACCACACTGAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-130s1c1
Sequence:CCGGGACAAGCAGGATCAGATCATTCTCGAGAATGATCTGATCCTGCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-268s1c1
Sequence:CCGGGCAGATGCCAAGTACACATTTCTCGAGAAATGTGTACTTGGCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177197
IDI2 MISSION shRNA shRNA Plasmid DNA
isopentenyl-diphosphate delta isomerase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177197.2-1640s1c1
Sequence:CCGGGCCTCCTAGAACTGTGACAAACTCGAGTTTGTCACAGTTCTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-420s1c1
Sequence:CCGGCCAGATTTCCATAAAGGACATCTCGAGATGTCCTTTATGGAAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-212s1c1
Sequence:CCGGGAGCCTTCAGTGTGGTCCTTTCTCGAGAAAGGACCACACTGAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-130s1c1
Sequence:CCGGGACAAGCAGGATCAGATCATTCTCGAGAATGATCTGATCCTGCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-268s1c1
Sequence:CCGGGCAGATGCCAAGTACACATTTCTCGAGAAATGTGTACTTGGCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177197
IDI2 MISSION shRNA Lentiviral Transduction Particles
isopentenyl-diphosphate delta isomerase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177197.2-1640s1c1
Sequence:CCGGGCCTCCTAGAACTGTGACAAACTCGAGTTTGTCACAGTTCTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-420s1c1
Sequence:CCGGCCAGATTTCCATAAAGGACATCTCGAGATGTCCTTTATGGAAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-212s1c1
Sequence:CCGGGAGCCTTCAGTGTGGTCCTTTCTCGAGAAAGGACCACACTGAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-130s1c1
Sequence:CCGGGACAAGCAGGATCAGATCATTCTCGAGAATGATCTGATCCTGCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177197.2-268s1c1
Sequence:CCGGGCAGATGCCAAGTACACATTTCTCGAGAAATGTGTACTTGGCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033261
IDI2 MISSION shRNA Bacterial Glycerol Stock
isopentenyl-diphosphate delta isomerase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-330s1c1
Sequence:CCGGCCATTATACAACCCAGCAGAACTCGAGTTCTGCTGGGTTGTATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-120s1c1
Sequence:CCGGGAAATGCTGATTGTTGTGGATCTCGAGATCCACAACAATCAGCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-455s1c1
Sequence:CCGGCATGACAATCTATCACCACAACTCGAGTTGTGGTGATAGATTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-714s1c1
Sequence:CCGGCCGTTTGTGGAGCTTCACAAACTCGAGTTTGTGAAGCTCCACAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-428s1c1
Sequence:CCGGGCAGATTTCTCCAGAGGACATCTCGAGATGTCCTCTGGAGAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033261.2-1185s21c1
Sequence:CCGGGTGCAACACAAGGCTGCATTTCTCGAGAAATGCAGCCTTGTGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033261.2-223s21c1
Sequence:CCGGCCTTCAGCGTTGTCTTGTTTACTCGAGTAAACAAGACAACGCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033261
IDI2 MISSION shRNA shRNA Plasmid DNA
isopentenyl-diphosphate delta isomerase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-330s1c1
Sequence:CCGGCCATTATACAACCCAGCAGAACTCGAGTTCTGCTGGGTTGTATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-120s1c1
Sequence:CCGGGAAATGCTGATTGTTGTGGATCTCGAGATCCACAACAATCAGCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-455s1c1
Sequence:CCGGCATGACAATCTATCACCACAACTCGAGTTGTGGTGATAGATTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-714s1c1
Sequence:CCGGCCGTTTGTGGAGCTTCACAAACTCGAGTTTGTGAAGCTCCACAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-428s1c1
Sequence:CCGGGCAGATTTCTCCAGAGGACATCTCGAGATGTCCTCTGGAGAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033261.2-1185s21c1
Sequence:CCGGGTGCAACACAAGGCTGCATTTCTCGAGAAATGCAGCCTTGTGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033261.2-223s21c1
Sequence:CCGGCCTTCAGCGTTGTCTTGTTTACTCGAGTAAACAAGACAACGCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033261
IDI2 MISSION shRNA Lentiviral Transduction Particles
isopentenyl-diphosphate delta isomerase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-330s1c1
Sequence:CCGGCCATTATACAACCCAGCAGAACTCGAGTTCTGCTGGGTTGTATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-120s1c1
Sequence:CCGGGAAATGCTGATTGTTGTGGATCTCGAGATCCACAACAATCAGCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-455s1c1
Sequence:CCGGCATGACAATCTATCACCACAACTCGAGTTGTGGTGATAGATTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-714s1c1
Sequence:CCGGCCGTTTGTGGAGCTTCACAAACTCGAGTTTGTGAAGCTCCACAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033261.2-428s1c1
Sequence:CCGGGCAGATTTCTCCAGAGGACATCTCGAGATGTCCTCTGGAGAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033261.2-1185s21c1
Sequence:CCGGGTGCAACACAAGGCTGCATTTCTCGAGAAATGCAGCCTTGTGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033261.2-223s21c1
Sequence:CCGGCCTTCAGCGTTGTCTTGTTTACTCGAGTAAACAAGACAACGCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)