EMAIL THIS PAGE TO A FRIEND

IDNK

idnK, gluconokinase homolog (E. coli)

75 Gene Product Result for
Synonyms: C9orf103 bA522I20.2
UniProtKB ID: Q5T6J7, A5PLN6, Q5T6J6
Gene ID:
Mouse(75731) idnK gluconokinase homolog (E. coli)
Rat(498695) idnK, gluconokinase homolog (E. coli)
dog(484150) idnK, gluconokinase homolog (E. coli)
domestic guinea pig(100730213) idnK, gluconokinase homolog (E. coli)
naked mole-rat(101716111) idnK, gluconokinase homolog (E. coli)
sheep(101115944) idnK, gluconokinase homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001551 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074661 MISSION® esiRNA esiRNA targeting mouse 5133401N09Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001551 Rosetta Predictions human pricing
NM_001037362 Rosetta Predictions rat pricing
NM_001048060 Rosetta Predictions mouse pricing
NM_198004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303821 predicted 1343
2 SASI_Hs01_00079755 predicted 1086
3 SASI_Hs01_00079756 predicted 1002
4 SASI_Hs01_00079757 predicted 1297
5 SASI_Hs01_00079758 predicted 1069
6 SASI_Hs01_00079759 predicted 1384
7 SASI_Hs01_00079761 predicted 969
8 SASI_Hs01_00079762 predicted 1233
9 SASI_Hs02_00303822 predicted 1082
10 SASI_Hs01_00079763 predicted 1305
11 SASI_Hs01_00079754 predicted 1366
12 SASI_Hs01_00079760 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061724 predicted 606
2 SASI_Rn01_00061725 predicted 806
3 SASI_Rn01_00061726 predicted 798
4 SASI_Rn01_00061727 predicted 241
5 SASI_Rn01_00061728 predicted 725
6 SASI_Rn01_00061729 predicted 374
7 SASI_Rn01_00061731 predicted 695
8 SASI_Rn01_00061732 predicted 308
9 SASI_Rn02_00204415 predicted 603
10 SASI_Rn02_00204416 predicted 418
11 SASI_Rn01_00061723 predicted 425
12 SASI_Rn01_00061730 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291991 predicted 412
2 SASI_Mm02_00291992 predicted 498
3 SASI_Mm02_00291993 predicted 411
4 SASI_Mm02_00291994 predicted 503
5 SASI_Mm02_00291995 predicted 507
6 SASI_Mm02_00291996 predicted 540
7 SASI_Mm02_00291997 predicted 432
8 SASI_Mm02_00291998 predicted 412
9 SASI_Mm02_00291999 predicted 516
10 SASI_Mm02_00292000 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062795 predicted 465
2 SASI_Mm02_00350702 predicted 546
3 SASI_Mm01_00062797 predicted 455
4 SASI_Mm02_00350703 predicted 543
5 SASI_Mm02_00350704 predicted 552
6 SASI_Mm02_00350705 predicted 578
7 SASI_Mm02_00350706 predicted 474
8 SASI_Mm01_00062803 predicted 456
9 SASI_Mm02_00350707 predicted 557
10 SASI_Mm02_00350708 predicted 464
11 SASI_Mm01_00062796 predicted 371
12 SASI_Mm01_00062798 predicted 385
13 SASI_Mm01_00062799 predicted 451
14 SASI_Mm01_00062800 predicted 377
15 SASI_Mm01_00062801 predicted 351
16 SASI_Mm01_00062802 predicted 398
17 SASI_Mm01_00062804 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198004
VALIDATED
IDNK MISSION shRNA Bacterial Glycerol Stock
idnK, gluconokinase homolog (E. coli)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-191s1c1
Sequence:CCGGCTTTGCACCTTGCACGACATTCTCGAGAATGTCGTGCAAGGTGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-116s1c1
Sequence:CCGGGATTACCACTCCGAGGAGAATCTCGAGATTCTCCTCGGAGTGGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-127s1c1
Sequence:CCGGCGAGGAGAATCGGATAAAGATCTCGAGATCTTTATCCGATTCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-126s21c1
Sequence:CCGGATTCTATGATGCCGATGATTACTCGAGTAATCATCGGCATCATAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198004.2-761s21c1
Sequence:CCGGCATCGGGCTGTACTGTAAATTCTCGAGAATTTACAGTACAGCCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198004.2-406s21c1
Sequence:CCGGGGCTCGTTTGACATCATTTATCTCGAGATAAATGATGTCAAACGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-161s21c1
Sequence:CCGGATCGGATAAAGATGGCGAAAGCTCGAGCTTTCGCCATCTTTATCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-218s21c1
Sequence:CCGGTTTGCACCTTGCACGACATTTCTCGAGAAATGTCGTGCAAGGTGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198004
VALIDATED
IDNK MISSION shRNA shRNA Plasmid DNA
idnK, gluconokinase homolog (E. coli)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-191s1c1
Sequence:CCGGCTTTGCACCTTGCACGACATTCTCGAGAATGTCGTGCAAGGTGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-116s1c1
Sequence:CCGGGATTACCACTCCGAGGAGAATCTCGAGATTCTCCTCGGAGTGGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-127s1c1
Sequence:CCGGCGAGGAGAATCGGATAAAGATCTCGAGATCTTTATCCGATTCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-126s21c1
Sequence:CCGGATTCTATGATGCCGATGATTACTCGAGTAATCATCGGCATCATAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198004.2-761s21c1
Sequence:CCGGCATCGGGCTGTACTGTAAATTCTCGAGAATTTACAGTACAGCCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198004.2-406s21c1
Sequence:CCGGGGCTCGTTTGACATCATTTATCTCGAGATAAATGATGTCAAACGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-161s21c1
Sequence:CCGGATCGGATAAAGATGGCGAAAGCTCGAGCTTTCGCCATCTTTATCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-218s21c1
Sequence:CCGGTTTGCACCTTGCACGACATTTCTCGAGAAATGTCGTGCAAGGTGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198004
VALIDATED
IDNK MISSION shRNA Lentiviral Transduction Particles
idnK, gluconokinase homolog (E. coli)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-191s1c1
Sequence:CCGGCTTTGCACCTTGCACGACATTCTCGAGAATGTCGTGCAAGGTGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-116s1c1
Sequence:CCGGGATTACCACTCCGAGGAGAATCTCGAGATTCTCCTCGGAGTGGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198004.1-127s1c1
Sequence:CCGGCGAGGAGAATCGGATAAAGATCTCGAGATCTTTATCCGATTCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-126s21c1
Sequence:CCGGATTCTATGATGCCGATGATTACTCGAGTAATCATCGGCATCATAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198004.2-761s21c1
Sequence:CCGGCATCGGGCTGTACTGTAAATTCTCGAGAATTTACAGTACAGCCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198004.2-406s21c1
Sequence:CCGGGGCTCGTTTGACATCATTTATCTCGAGATAAATGATGTCAAACGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-161s21c1
Sequence:CCGGATCGGATAAAGATGGCGAAAGCTCGAGCTTTCGCCATCTTTATCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198004.2-218s21c1
Sequence:CCGGTTTGCACCTTGCACGACATTTCTCGAGAAATGTCGTGCAAGGTGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001551
VALIDATED
IDNK MISSION shRNA Bacterial Glycerol Stock
idnK, gluconokinase homolog (E. coli)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-1141s1c1
Sequence:CCGGCTGAATTATTGCAGTCCCAGTCTCGAGACTGGGACTGCAATAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-885s1c1
Sequence:CCGGCCATGGCTCTGTAACTTGCATCTCGAGATGCAAGTTACAGAGCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001551.1-881s1c1
Sequence:CCGGGATTCCATGGCTCTGTAACTTCTCGAGAAGTTACAGAGCCATGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001551.1-1002s1c1
Sequence:CCGGGATGGTGTAGCTCTGAAGTGTCTCGAGACACTTCAGAGCTACACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001551.1-979s1c1
Sequence:CCGGGAGACATATTAACACAAGGAACTCGAGTTCCTTGTGTTAATATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-1293s1c1
Sequence:CCGGCCAAACAGAACTAAGCATAAACTCGAGTTTATGCTTAGTTCTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-890s1c1
Sequence:CCGGGCTCTGTAACTTGCATGACATCTCGAGATGTCATGCAAGTTACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-1291s1c1
Sequence:CCGGGTCCAAACAGAACTAAGCATACTCGAGTATGCTTAGTTCTGTTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-1143s1c1
Sequence:CCGGGAATTATTGCAGTCCCAGTTTCTCGAGAAACTGGGACTGCAATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001551.1-1239s1c1
Sequence:CCGGGCTACAATTATGGAAACCCTACTCGAGTAGGGTTTCCATAATTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001551.1-1399s1c1
Sequence:CCGGGACAGACTTGTTTAGGTGTAACTCGAGTTACACCTAAACAAGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001551
VALIDATED
IDNK MISSION shRNA shRNA Plasmid DNA
idnK, gluconokinase homolog (E. coli)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-1141s1c1
Sequence:CCGGCTGAATTATTGCAGTCCCAGTCTCGAGACTGGGACTGCAATAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-885s1c1
Sequence:CCGGCCATGGCTCTGTAACTTGCATCTCGAGATGCAAGTTACAGAGCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001551.1-881s1c1
Sequence:CCGGGATTCCATGGCTCTGTAACTTCTCGAGAAGTTACAGAGCCATGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001551.1-1002s1c1
Sequence:CCGGGATGGTGTAGCTCTGAAGTGTCTCGAGACACTTCAGAGCTACACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001551.1-979s1c1
Sequence:CCGGGAGACATATTAACACAAGGAACTCGAGTTCCTTGTGTTAATATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-1293s1c1
Sequence:CCGGCCAAACAGAACTAAGCATAAACTCGAGTTTATGCTTAGTTCTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-890s1c1
Sequence:CCGGGCTCTGTAACTTGCATGACATCTCGAGATGTCATGCAAGTTACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-1291s1c1
Sequence:CCGGGTCCAAACAGAACTAAGCATACTCGAGTATGCTTAGTTCTGTTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-1143s1c1
Sequence:CCGGGAATTATTGCAGTCCCAGTTTCTCGAGAAACTGGGACTGCAATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001551.1-1239s1c1
Sequence:CCGGGCTACAATTATGGAAACCCTACTCGAGTAGGGTTTCCATAATTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001551.1-1399s1c1
Sequence:CCGGGACAGACTTGTTTAGGTGTAACTCGAGTTACACCTAAACAAGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001551
VALIDATED
IDNK MISSION shRNA Lentiviral Transduction Particles
idnK, gluconokinase homolog (E. coli)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-1141s1c1
Sequence:CCGGCTGAATTATTGCAGTCCCAGTCTCGAGACTGGGACTGCAATAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-885s1c1
Sequence:CCGGCCATGGCTCTGTAACTTGCATCTCGAGATGCAAGTTACAGAGCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001551.1-881s1c1
Sequence:CCGGGATTCCATGGCTCTGTAACTTCTCGAGAAGTTACAGAGCCATGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001551.1-1002s1c1
Sequence:CCGGGATGGTGTAGCTCTGAAGTGTCTCGAGACACTTCAGAGCTACACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001551.1-979s1c1
Sequence:CCGGGAGACATATTAACACAAGGAACTCGAGTTCCTTGTGTTAATATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-1293s1c1
Sequence:CCGGCCAAACAGAACTAAGCATAAACTCGAGTTTATGCTTAGTTCTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-890s1c1
Sequence:CCGGGCTCTGTAACTTGCATGACATCTCGAGATGTCATGCAAGTTACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001001551.1-1291s1c1
Sequence:CCGGGTCCAAACAGAACTAAGCATACTCGAGTATGCTTAGTTCTGTTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001551.1-1143s1c1
Sequence:CCGGGAATTATTGCAGTCCCAGTTTCTCGAGAAACTGGGACTGCAATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001551.1-1239s1c1
Sequence:CCGGGCTACAATTATGGAAACCCTACTCGAGTAGGGTTTCCATAATTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001551.1-1399s1c1
Sequence:CCGGGACAGACTTGTTTAGGTGTAACTCGAGTTACACCTAAACAAGTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)