EMAIL THIS PAGE TO A FRIEND

IDO2

indoleamine 2,3-dioxygenase 2

174 Gene Product Result for
Synonyms: INDOL1
UniProtKB ID: Q6ZQW0, A4UD41
Gene ID:
Human(169355) Summary: Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]
Mouse(209176) indoleamine 2,3-dioxygenase 2
Rat(681319) indoleamine 2,3-dioxygenase 2
dog(482846) indoleamine 2,3-dioxygenase 2
domestic cat(101096722) indoleamine 2,3-dioxygenase 2
cow(513810) indoleamine 2,3-dioxygenase 2
Horse(100056686) indoleamine 2,3-dioxygenase 2
domestic guinea pig(100727752) indoleamine 2,3-dioxygenase 2
naked mole-rat(101723386) indoleamine 2,3-dioxygenase 2
sheep(101120548) indoleamine 2,3-dioxygenase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122211 MISSION® esiRNA esiRNA human INDOL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194294 Rosetta Predictions human pricing
XM_001061228 Rosetta Predictions rat pricing
NM_145949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371425 predicted 1457
2 SASI_Hs02_00371426 predicted 317
3 SASI_Hs02_00371427 predicted 1434
4 SASI_Hs02_00371428 predicted 1435
5 SASI_Hs02_00371429 predicted 1437
6 SASI_Hs02_00371430 predicted 1458
7 SASI_Hs02_00371431 predicted 424
8 SASI_Hs02_00371432 predicted 1324
9 SASI_Hs02_00371433 predicted 398
10 SASI_Hs02_00371434 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299274 predicted 245
2 SASI_Rn02_00299275 predicted 979
3 SASI_Rn02_00299276 predicted 509
4 SASI_Rn02_00299277 predicted 216
5 SASI_Rn02_00299278 predicted 1156
6 SASI_Rn02_00299279 predicted 1012
7 SASI_Rn02_00299280 predicted 662
8 SASI_Rn02_00299281 predicted 875
9 SASI_Rn02_00299282 predicted 499
10 SASI_Rn02_00299283 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185474 predicted 206
2 SASI_Mm01_00185475 predicted 1305
3 SASI_Mm01_00185476 predicted 1380
4 SASI_Mm01_00185477 predicted 934
5 SASI_Mm02_00341414 predicted 921
6 SASI_Mm01_00185479 predicted 978
7 SASI_Mm01_00185480 predicted 1112
8 SASI_Mm01_00185481 predicted 640
9 SASI_Mm02_00341415 predicted 989
10 SASI_Mm01_00185483 predicted 457
11 SASI_Mm01_00185478 predicted 624
12 SASI_Mm01_00185482 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194294
IDO2 MISSION shRNA Bacterial Glycerol Stock
indoleamine 2,3-dioxygenase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-604s1c1
Sequence:CCGGCAAGGAATCTTGCCCTTCCATCTCGAGATGGAAGGGCAAGATTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-2500s1c1
Sequence:CCGGCCTGGGATAAAGGCTCTTGTTCTCGAGAACAAGAGCCTTTATCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-312s1c1
Sequence:CCGGGCAGTGCCATTGTCTTTGGAACTCGAGTTCCAAAGACAATGGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-3064s1c1
Sequence:CCGGCCGCAGTTATGAGCTTTCTTACTCGAGTAAGAAAGCTCATAACTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-330s1c1
Sequence:CCGGGAAAGCTATCACATATCTGAACTCGAGTTCAGATATGTGATAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-318s1c1
Sequence:CCGGCCATTGTCTTTGGAAAGCTATCTCGAGATAGCTTTCCAAAGACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-3065s1c1
Sequence:CCGGCGCAGTTATGAGCTTTCTTAACTCGAGTTAAGAAAGCTCATAACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-363s1c1
Sequence:CCGGCTTCTTCCAGATTCTCTGAAACTCGAGTTTCAGAGAATCTGGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-325s1c1
Sequence:CCGGCTTTGGAAAGCTATCACATATCTCGAGATATGTGATAGCTTTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-455s1c1
Sequence:CCGGGCTTCAAGCTCATGTGGACAACTCGAGTTGTCCACATGAGCTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194294
IDO2 MISSION shRNA shRNA Plasmid DNA
indoleamine 2,3-dioxygenase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-604s1c1
Sequence:CCGGCAAGGAATCTTGCCCTTCCATCTCGAGATGGAAGGGCAAGATTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-2500s1c1
Sequence:CCGGCCTGGGATAAAGGCTCTTGTTCTCGAGAACAAGAGCCTTTATCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-312s1c1
Sequence:CCGGGCAGTGCCATTGTCTTTGGAACTCGAGTTCCAAAGACAATGGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-3064s1c1
Sequence:CCGGCCGCAGTTATGAGCTTTCTTACTCGAGTAAGAAAGCTCATAACTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-330s1c1
Sequence:CCGGGAAAGCTATCACATATCTGAACTCGAGTTCAGATATGTGATAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-318s1c1
Sequence:CCGGCCATTGTCTTTGGAAAGCTATCTCGAGATAGCTTTCCAAAGACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-3065s1c1
Sequence:CCGGCGCAGTTATGAGCTTTCTTAACTCGAGTTAAGAAAGCTCATAACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-363s1c1
Sequence:CCGGCTTCTTCCAGATTCTCTGAAACTCGAGTTTCAGAGAATCTGGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-325s1c1
Sequence:CCGGCTTTGGAAAGCTATCACATATCTCGAGATATGTGATAGCTTTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-455s1c1
Sequence:CCGGGCTTCAAGCTCATGTGGACAACTCGAGTTGTCCACATGAGCTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194294
IDO2 MISSION shRNA Lentiviral Transduction Particles
indoleamine 2,3-dioxygenase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-604s1c1
Sequence:CCGGCAAGGAATCTTGCCCTTCCATCTCGAGATGGAAGGGCAAGATTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-2500s1c1
Sequence:CCGGCCTGGGATAAAGGCTCTTGTTCTCGAGAACAAGAGCCTTTATCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-312s1c1
Sequence:CCGGGCAGTGCCATTGTCTTTGGAACTCGAGTTCCAAAGACAATGGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-3064s1c1
Sequence:CCGGCCGCAGTTATGAGCTTTCTTACTCGAGTAAGAAAGCTCATAACTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-330s1c1
Sequence:CCGGGAAAGCTATCACATATCTGAACTCGAGTTCAGATATGTGATAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-318s1c1
Sequence:CCGGCCATTGTCTTTGGAAAGCTATCTCGAGATAGCTTTCCAAAGACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194294.1-3065s1c1
Sequence:CCGGCGCAGTTATGAGCTTTCTTAACTCGAGTTAAGAAAGCTCATAACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-363s1c1
Sequence:CCGGCTTCTTCCAGATTCTCTGAAACTCGAGTTTCAGAGAATCTGGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-325s1c1
Sequence:CCGGCTTTGGAAAGCTATCACATATCTCGAGATATGTGATAGCTTTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194294.1-455s1c1
Sequence:CCGGGCTTCAAGCTCATGTGGACAACTCGAGTTGTCCACATGAGCTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145949
IDO2 MISSION shRNA Bacterial Glycerol Stock
indoleamine 2,3-dioxygenase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-1066s21c1
Sequence:CCGGGGACTGCCTGATGGCCTATAACTCGAGTTATAGGCCATCAGGCAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-184s21c1
Sequence:CCGGGGAAGCACTTCCAGATCATTACTCGAGTAATGATCTGGAAGTGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145949.2-2823s21c1
Sequence:CCGGTAGACATTGTCGGTTCTATTTCTCGAGAAATAGAACCGACAATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-736s21c1
Sequence:CCGGCTTGGCCCAAATGCATGATTACTCGAGTAATCATGCATTTGGGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-1131s21c1
Sequence:CCGGATGTCGTGGCCAGATACATTACTCGAGTAATGTATCTGGCCACGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145949
IDO2 MISSION shRNA shRNA Plasmid DNA
indoleamine 2,3-dioxygenase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-1066s21c1
Sequence:CCGGGGACTGCCTGATGGCCTATAACTCGAGTTATAGGCCATCAGGCAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-184s21c1
Sequence:CCGGGGAAGCACTTCCAGATCATTACTCGAGTAATGATCTGGAAGTGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145949.2-2823s21c1
Sequence:CCGGTAGACATTGTCGGTTCTATTTCTCGAGAAATAGAACCGACAATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-736s21c1
Sequence:CCGGCTTGGCCCAAATGCATGATTACTCGAGTAATCATGCATTTGGGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-1131s21c1
Sequence:CCGGATGTCGTGGCCAGATACATTACTCGAGTAATGTATCTGGCCACGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145949
IDO2 MISSION shRNA Lentiviral Transduction Particles
indoleamine 2,3-dioxygenase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-1066s21c1
Sequence:CCGGGGACTGCCTGATGGCCTATAACTCGAGTTATAGGCCATCAGGCAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-184s21c1
Sequence:CCGGGGAAGCACTTCCAGATCATTACTCGAGTAATGATCTGGAAGTGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145949.2-2823s21c1
Sequence:CCGGTAGACATTGTCGGTTCTATTTCTCGAGAAATAGAACCGACAATGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-736s21c1
Sequence:CCGGCTTGGCCCAAATGCATGATTACTCGAGTAATCATGCATTTGGGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145949.2-1131s21c1
Sequence:CCGGATGTCGTGGCCAGATACATTACTCGAGTAATGTATCTGGCCACGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)