EMAIL THIS PAGE TO A FRIEND

IDS

iduronate 2-sulfatase

236 Gene Product Result for
Synonyms: MPS2 SIDS
UniProtKB ID: P22304, D3DWT4, Q14604, Q9BRM3
Gene ID:
Human(3423) Summary: Iduronate-2-sulfatase is required for the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this X-chromosome gene that result in enzymatic deficiency lead to the sex-linked Mucopolysaccharidosis Type II, also known as Hunter Syndrome. Iduronate-2-sulfatase has a strong sequence similarity with human arylsulfatases A, B, and C, and human glucosamine-6-sulfatase. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2009]
Mouse(15931) iduronate 2-sulfatase
Rat(363513) iduronate 2-sulfatase
sheep(101116540) iduronate 2-sulfatase
Domestic Rabbit(100356659) iduronate 2-sulfatase
domestic guinea pig(100717247) iduronate 2-sulfatase
naked mole-rat(101710577) iduronate 2-sulfatase
Zebrafish(559959) iduronate 2-sulfatase
chicken(422392) iduronate 2-sulfatase
cow(541272) iduronate 2-sulfatase
domestic cat(101081450) iduronate 2-sulfatase
dog(492194) iduronate 2-sulfatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059341 MISSION® esiRNA esiRNA human IDS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000202 Rosetta Predictions human pricing
NM_006123 Rosetta Predictions human pricing
XM_001054447 Rosetta Predictions rat pricing
XM_579042 Rosetta Predictions rat pricing
NM_001038990 Rosetta Predictions mouse pricing
NM_001038991 Rosetta Predictions mouse pricing
NM_010498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072311 predicted 432
2 SASI_Hs01_00072312 predicted 504
3 SASI_Hs01_00072313 predicted 526
4 SASI_Hs02_00302076 predicted 666
5 SASI_Hs02_00302077 predicted 232
6 SASI_Hs02_00302078 predicted 221
7 SASI_Hs02_00302079 predicted 223
8 SASI_Hs01_00072314 predicted 350
9 SASI_Hs01_00072315 predicted 722
10 SASI_Hs01_00072316 predicted 423
11 SASI_Hs01_00072310 predicted 754
12 SASI_Hs01_00072317 predicted 990
13 SASI_Hs01_00072318 predicted 706
14 SASI_Hs01_00072319 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177938 predicted 432
2 SASI_Hs01_00177939 predicted 503
3 SASI_Hs01_00177940 predicted 523
4 SASI_Hs02_00340950 predicted 663
5 SASI_Hs02_00340951 predicted 228
6 SASI_Hs02_00340952 predicted 225
7 SASI_Hs02_00340953 predicted 221
8 SASI_Hs01_00177941 predicted 347
9 SASI_Hs01_00177942 predicted 722
10 SASI_Hs01_00177943 predicted 426
11 SASI_Hs01_00177937 predicted 542
12 SASI_Hs01_00177944 predicted 788
13 SASI_Hs01_00177945 predicted 504
14 SASI_Hs01_00177946 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275815 predicted 253
2 SASI_Rn02_00275816 predicted 413
3 SASI_Rn02_00275817 predicted 251
4 SASI_Rn02_00275818 predicted 356
5 SASI_Rn02_00275819 predicted 365
6 SASI_Rn02_00275820 predicted 387
7 SASI_Rn02_00275821 predicted 251
8 SASI_Rn02_00275822 predicted 405
9 SASI_Rn02_00275823 predicted 363
10 SASI_Rn02_00275824 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408536 predicted 1121
2 SASI_Rn02_00408537 predicted 1515
3 SASI_Rn02_00408538 predicted 1511
4 SASI_Rn02_00408539 predicted 1718
5 SASI_Rn02_00408540 predicted 908
6 SASI_Rn02_00408541 predicted 1952
7 SASI_Rn02_00408542 predicted 615
8 SASI_Rn02_00408543 predicted 1918
9 SASI_Rn02_00408544 predicted 513
10 SASI_Rn02_00408545 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035635 predicted 1590
2 SASI_Mm01_00035636 predicted 1587
3 SASI_Mm01_00035637 predicted 1369
4 SASI_Mm01_00035638 predicted 1515
5 SASI_Mm01_00035639 predicted 473
6 SASI_Mm01_00035640 predicted 1482
7 SASI_Mm01_00035641 predicted 1489
8 SASI_Mm01_00035642 predicted 640
9 SASI_Mm01_00035643 predicted 661
10 SASI_Mm01_00035644 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138977 predicted 1587
2 SASI_Mm01_00138978 predicted 1591
3 SASI_Mm01_00138979 predicted 1370
4 SASI_Mm01_00138980 predicted 1520
5 SASI_Mm01_00138981 predicted 471
6 SASI_Mm01_00138982 predicted 1479
7 SASI_Mm01_00138983 predicted 1492
8 SASI_Mm01_00138984 predicted 644
9 SASI_Mm01_00138985 predicted 655
10 SASI_Mm01_00138986 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060504 predicted 1702
2 SASI_Mm01_00060505 predicted 1705
3 SASI_Mm01_00060506 predicted 1484
4 SASI_Mm01_00060507 predicted 1636
5 SASI_Mm01_00060508 predicted 584
6 SASI_Mm01_00060509 predicted 489
7 SASI_Mm01_00060510 predicted 1597
8 SASI_Mm01_00060511 predicted 1605
9 SASI_Mm01_00060512 predicted 754
10 SASI_Mm01_00060513 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010498
VALIDATED
IDS MISSION shRNA Bacterial Glycerol Stock
iduronate 2-sulfatase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-2071s21c1
Sequence:CCGGCAAAGTGAACTAAGGTATAATCTCGAGATTATACCTTAGTTCACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-490s21c1
Sequence:CCGGCCTGTATGACTTCAATTCCTACTCGAGTAGGAATTGAAGTCATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-1492s21c1
Sequence:CCGGCCAGAATCTTCAGAAGCATTTCTCGAGAAATGCTTCTGAAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-1159s21c1
Sequence:CCGGCCACAACACAATTATTGCTTTCTCGAGAAAGCAATAATTGTGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-1037s1c1
Sequence:CCGGCCACAACACAATTATTGCTTTCTCGAGAAAGCAATAATTGTGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-1369s1c1
Sequence:CCGGCCAGAATCTTCAGAAGCATTTCTCGAGAAATGCTTCTGAAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-368s1c1
Sequence:CCGGCCTGTATGACTTCAATTCCTACTCGAGTAGGAATTGAAGTCATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010498.1-1108s1c1
Sequence:CCGGACAGCAACTTTGATGTTGCTACTCGAGTAGCAACATCAAAGTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010498
VALIDATED
IDS MISSION shRNA shRNA Plasmid DNA
iduronate 2-sulfatase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-2071s21c1
Sequence:CCGGCAAAGTGAACTAAGGTATAATCTCGAGATTATACCTTAGTTCACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-490s21c1
Sequence:CCGGCCTGTATGACTTCAATTCCTACTCGAGTAGGAATTGAAGTCATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-1492s21c1
Sequence:CCGGCCAGAATCTTCAGAAGCATTTCTCGAGAAATGCTTCTGAAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-1159s21c1
Sequence:CCGGCCACAACACAATTATTGCTTTCTCGAGAAAGCAATAATTGTGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-1037s1c1
Sequence:CCGGCCACAACACAATTATTGCTTTCTCGAGAAAGCAATAATTGTGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-1369s1c1
Sequence:CCGGCCAGAATCTTCAGAAGCATTTCTCGAGAAATGCTTCTGAAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-368s1c1
Sequence:CCGGCCTGTATGACTTCAATTCCTACTCGAGTAGGAATTGAAGTCATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010498.1-1108s1c1
Sequence:CCGGACAGCAACTTTGATGTTGCTACTCGAGTAGCAACATCAAAGTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010498
VALIDATED
IDS MISSION shRNA Lentiviral Transduction Particles
iduronate 2-sulfatase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-2071s21c1
Sequence:CCGGCAAAGTGAACTAAGGTATAATCTCGAGATTATACCTTAGTTCACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-490s21c1
Sequence:CCGGCCTGTATGACTTCAATTCCTACTCGAGTAGGAATTGAAGTCATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-1492s21c1
Sequence:CCGGCCAGAATCTTCAGAAGCATTTCTCGAGAAATGCTTCTGAAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010498.2-1159s21c1
Sequence:CCGGCCACAACACAATTATTGCTTTCTCGAGAAAGCAATAATTGTGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-1037s1c1
Sequence:CCGGCCACAACACAATTATTGCTTTCTCGAGAAAGCAATAATTGTGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-1369s1c1
Sequence:CCGGCCAGAATCTTCAGAAGCATTTCTCGAGAAATGCTTCTGAAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010498.1-368s1c1
Sequence:CCGGCCTGTATGACTTCAATTCCTACTCGAGTAGGAATTGAAGTCATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010498.1-1108s1c1
Sequence:CCGGACAGCAACTTTGATGTTGCTACTCGAGTAGCAACATCAAAGTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000202
VALIDATED
IDS MISSION shRNA Bacterial Glycerol Stock
iduronate 2-sulfatase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-632s21c1
Sequence:CCGGATACCGATGATTCTCCGTATACTCGAGTATACGGAGAATCATCGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-1788s21c1
Sequence:CCGGGCAGGATCACAATATGTATAACTCGAGTTATACATATTGTGATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-1103s21c1
Sequence:CCGGCCTCTGTGTCATATTTGGATACTCGAGTATCCAAATATGACACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-501s21c1
Sequence:CCGGCCTGTACGACTTCAACTCCTACTCGAGTAGGAGTTGAAGTCGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000202.4-2309s21c1
Sequence:CCGGATATCTTATGAGCCCTATATACTCGAGTATATAGGGCTCATAAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-634s1c1
Sequence:CCGGCCTGTACGACTTCAACTCCTACTCGAGTAGGAGTTGAAGTCGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1236s1c1
Sequence:CCGGCCTCTGTGTCATATTTGGATACTCGAGTATCCAAATATGACACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1921s1c1
Sequence:CCGGGCAGGATCACAATATGTATAACTCGAGTTATACATATTGTGATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1701s1c1
Sequence:CCGGCCCGTGAACTGATTGCCTATACTCGAGTATAGGCAATCAGTTCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1781s1c1
Sequence:CCGGGATATAAAGATCATGGGCTATCTCGAGATAGCCCATGATCTTTATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000202
VALIDATED
IDS MISSION shRNA shRNA Plasmid DNA
iduronate 2-sulfatase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-632s21c1
Sequence:CCGGATACCGATGATTCTCCGTATACTCGAGTATACGGAGAATCATCGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-1788s21c1
Sequence:CCGGGCAGGATCACAATATGTATAACTCGAGTTATACATATTGTGATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-1103s21c1
Sequence:CCGGCCTCTGTGTCATATTTGGATACTCGAGTATCCAAATATGACACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-501s21c1
Sequence:CCGGCCTGTACGACTTCAACTCCTACTCGAGTAGGAGTTGAAGTCGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000202.4-2309s21c1
Sequence:CCGGATATCTTATGAGCCCTATATACTCGAGTATATAGGGCTCATAAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-634s1c1
Sequence:CCGGCCTGTACGACTTCAACTCCTACTCGAGTAGGAGTTGAAGTCGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1236s1c1
Sequence:CCGGCCTCTGTGTCATATTTGGATACTCGAGTATCCAAATATGACACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1921s1c1
Sequence:CCGGGCAGGATCACAATATGTATAACTCGAGTTATACATATTGTGATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1701s1c1
Sequence:CCGGCCCGTGAACTGATTGCCTATACTCGAGTATAGGCAATCAGTTCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1781s1c1
Sequence:CCGGGATATAAAGATCATGGGCTATCTCGAGATAGCCCATGATCTTTATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000202
VALIDATED
IDS MISSION shRNA Lentiviral Transduction Particles
iduronate 2-sulfatase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-632s21c1
Sequence:CCGGATACCGATGATTCTCCGTATACTCGAGTATACGGAGAATCATCGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-1788s21c1
Sequence:CCGGGCAGGATCACAATATGTATAACTCGAGTTATACATATTGTGATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-1103s21c1
Sequence:CCGGCCTCTGTGTCATATTTGGATACTCGAGTATCCAAATATGACACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000202.4-501s21c1
Sequence:CCGGCCTGTACGACTTCAACTCCTACTCGAGTAGGAGTTGAAGTCGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000202.4-2309s21c1
Sequence:CCGGATATCTTATGAGCCCTATATACTCGAGTATATAGGGCTCATAAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-634s1c1
Sequence:CCGGCCTGTACGACTTCAACTCCTACTCGAGTAGGAGTTGAAGTCGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1236s1c1
Sequence:CCGGCCTCTGTGTCATATTTGGATACTCGAGTATCCAAATATGACACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1921s1c1
Sequence:CCGGGCAGGATCACAATATGTATAACTCGAGTTATACATATTGTGATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1701s1c1
Sequence:CCGGCCCGTGAACTGATTGCCTATACTCGAGTATAGGCAATCAGTTCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000202.2-1781s1c1
Sequence:CCGGGATATAAAGATCATGGGCTATCTCGAGATAGCCCATGATCTTTATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)