EMAIL THIS PAGE TO A FRIEND

IDUA

iduronidase, alpha-L-

66 Gene Product Result for
Synonyms: IDA MPS1
UniProtKB ID: P35475
Gene ID:
Human(3425) Summary: This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
Mouse(15932) iduronidase, alpha-L-
Rat(360904) alpha-L-iduronidase
Rat(100361089) iduronidase, alpha-L-
Zebrafish(567720) iduronidase, alpha-L-
chicken(427294) iduronidase, alpha-L-
domestic cat(101095896) iduronidase, alpha-L-
Horse(100146682) iduronidase, alpha-L-
cow(511050) iduronidase, alpha-L-
domestic guinea pig(100720499) iduronidase, alpha-L-
naked mole-rat(101725783) iduronidase, alpha-L-
sheep(101105916) iduronidase, alpha-L-
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1510 Human IDUA ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000203 Rosetta Predictions human pricing
NM_008325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025887 predicted 808
2 SASI_Hs01_00025888 predicted 1876
3 SASI_Hs01_00025890 predicted 1811
4 SASI_Hs01_00025891 predicted 632
5 SASI_Hs01_00025892 predicted 1762
6 SASI_Hs01_00025893 predicted 592
7 SASI_Hs01_00025894 predicted 1837
8 SASI_Hs01_00025895 predicted 1828
9 SASI_Hs02_00302080 predicted 496
10 SASI_Hs01_00025896 predicted 1054
11 SASI_Hs01_00025889 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044239 predicted 733
2 SASI_Mm01_00044241 predicted 772
3 SASI_Mm01_00044242 predicted 1479
4 SASI_Mm01_00044243 predicted 544
5 SASI_Mm02_00313646 predicted 501
6 SASI_Mm01_00044244 predicted 744
7 SASI_Mm02_00313647 predicted 1336
8 SASI_Mm01_00044246 predicted 562
9 SASI_Mm02_00313648 predicted 1346
10 SASI_Mm02_00313649 predicted 1603
11 SASI_Mm01_00044240 predicted 1024
12 SASI_Mm01_00044245 predicted 1084
13 SASI_Mm01_00044247 predicted 1751
14 SASI_Mm01_00044248 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000203
VALIDATED
IDUA MISSION shRNA Bacterial Glycerol Stock
iduronidase, alpha-L-
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-598s1c1
Sequence:CCGGGCATGTTTCCAAGTGGAACTTCTCGAGAAGTTCCACTTGGAAACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-568s1c1
Sequence:CCGGCAGGAGATACATCGGTAGGTACTCGAGTACCTACCGATGTATCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-673s1c1
Sequence:CCGGGCAAGGCTTCCTGAACTACTACTCGAGTAGTAGTTCAGGAAGCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-1822s1c1
Sequence:CCGGGTGGACATACGAGATCCAGTTCTCGAGAACTGGATCTCGTATGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-1883s1c1
Sequence:CCGGCCATCGACCTTCAACCTCTTTCTCGAGAAAGAGGTTGAAGGTCGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-645s21c1
Sequence:CCGGACGACTTTGACAACGTCTCCACTCGAGTGGAGACGTTGTCAAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1119s21c1
Sequence:CCGGCGCTCCTGAGCAACGACAATGCTCGAGCATTGTCGTTGCTCAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-612s21c1
Sequence:CCGGGGAACTTCGAGACGTGGAATGCTCGAGCATTCCACGTCTCGAAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-519s21c1
Sequence:CCGGAGGACAAGCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGCTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1811s21c1
Sequence:CCGGTCCAAGTGCCTGTGGACATACCTCGAGGTATGTCCACAGGCACTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1838s21c1
Sequence:CCGGCAGTTCTCTCAGGACGGTAAGCTCGAGCTTACCGTCCTGAGAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1781s21c1
Sequence:CCGGGTTCTGGTCTGGTCGGATGAACTCGAGTTCATCCGACCAGACCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-673s21c1
Sequence:CCGGGCAAGGCTTCCTGAACTACTACTCGAGTAGTAGTTCAGGAAGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000203
VALIDATED
IDUA MISSION shRNA shRNA Plasmid DNA
iduronidase, alpha-L-
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-598s1c1
Sequence:CCGGGCATGTTTCCAAGTGGAACTTCTCGAGAAGTTCCACTTGGAAACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-568s1c1
Sequence:CCGGCAGGAGATACATCGGTAGGTACTCGAGTACCTACCGATGTATCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-673s1c1
Sequence:CCGGGCAAGGCTTCCTGAACTACTACTCGAGTAGTAGTTCAGGAAGCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-1822s1c1
Sequence:CCGGGTGGACATACGAGATCCAGTTCTCGAGAACTGGATCTCGTATGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-1883s1c1
Sequence:CCGGCCATCGACCTTCAACCTCTTTCTCGAGAAAGAGGTTGAAGGTCGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-645s21c1
Sequence:CCGGACGACTTTGACAACGTCTCCACTCGAGTGGAGACGTTGTCAAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1119s21c1
Sequence:CCGGCGCTCCTGAGCAACGACAATGCTCGAGCATTGTCGTTGCTCAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-612s21c1
Sequence:CCGGGGAACTTCGAGACGTGGAATGCTCGAGCATTCCACGTCTCGAAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-519s21c1
Sequence:CCGGAGGACAAGCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGCTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1811s21c1
Sequence:CCGGTCCAAGTGCCTGTGGACATACCTCGAGGTATGTCCACAGGCACTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1838s21c1
Sequence:CCGGCAGTTCTCTCAGGACGGTAAGCTCGAGCTTACCGTCCTGAGAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1781s21c1
Sequence:CCGGGTTCTGGTCTGGTCGGATGAACTCGAGTTCATCCGACCAGACCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-673s21c1
Sequence:CCGGGCAAGGCTTCCTGAACTACTACTCGAGTAGTAGTTCAGGAAGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000203
VALIDATED
IDUA MISSION shRNA Lentiviral Transduction Particles
iduronidase, alpha-L-
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-598s1c1
Sequence:CCGGGCATGTTTCCAAGTGGAACTTCTCGAGAAGTTCCACTTGGAAACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-568s1c1
Sequence:CCGGCAGGAGATACATCGGTAGGTACTCGAGTACCTACCGATGTATCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-673s1c1
Sequence:CCGGGCAAGGCTTCCTGAACTACTACTCGAGTAGTAGTTCAGGAAGCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-1822s1c1
Sequence:CCGGGTGGACATACGAGATCCAGTTCTCGAGAACTGGATCTCGTATGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000203.2-1883s1c1
Sequence:CCGGCCATCGACCTTCAACCTCTTTCTCGAGAAAGAGGTTGAAGGTCGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-645s21c1
Sequence:CCGGACGACTTTGACAACGTCTCCACTCGAGTGGAGACGTTGTCAAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1119s21c1
Sequence:CCGGCGCTCCTGAGCAACGACAATGCTCGAGCATTGTCGTTGCTCAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-612s21c1
Sequence:CCGGGGAACTTCGAGACGTGGAATGCTCGAGCATTCCACGTCTCGAAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-519s21c1
Sequence:CCGGAGGACAAGCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGCTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1811s21c1
Sequence:CCGGTCCAAGTGCCTGTGGACATACCTCGAGGTATGTCCACAGGCACTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1838s21c1
Sequence:CCGGCAGTTCTCTCAGGACGGTAAGCTCGAGCTTACCGTCCTGAGAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-1781s21c1
Sequence:CCGGGTTCTGGTCTGGTCGGATGAACTCGAGTTCATCCGACCAGACCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000203.3-673s21c1
Sequence:CCGGGCAAGGCTTCCTGAACTACTACTCGAGTAGTAGTTCAGGAAGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008325
VALIDATED
IDUA MISSION shRNA Bacterial Glycerol Stock
iduronidase, alpha-L-
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008325.1-2523s1c1
Sequence:CCGGGCACAGAGTAAGCATCTTCATCTCGAGATGAAGATGCTTACTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008325.1-308s1c1
Sequence:CCGGGCAGGGACTTATGTACAACTTCTCGAGAAGTTGTACATAAGTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008325.1-1413s1c1
Sequence:CCGGGTACTCTACTTAGACAATCAACTCGAGTTGATTGTCTAAGTAGAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008325.1-506s1c1
Sequence:CCGGACACGTTTCCAAGTGGAACTTCTCGAGAAGTTCCACTTGGAAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-664s21c1
Sequence:CCGGCTGGGTACTTCACGGACTTTGCTCGAGCAAAGTCCGTGAAGTACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-766s21c1
Sequence:CCGGACGTTTCCAAGTGGAACTTTGCTCGAGCAAAGTTCCACTTGGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-1354s21c1
Sequence:CCGGCTCGATTCCAGGTCAACAATACTCGAGTATTGTTGACCTGGAATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008325.3-2108s21c1
Sequence:CCGGCCGAGTTCGAGCATTGGATTACTCGAGTAATCCAATGCTCGAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008325.3-2524s21c1
Sequence:CCGGAGGCTGGGCATGGCAATATATCTCGAGATATATTGCCATGCCCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008325
VALIDATED
IDUA MISSION shRNA shRNA Plasmid DNA
iduronidase, alpha-L-
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008325.1-2523s1c1
Sequence:CCGGGCACAGAGTAAGCATCTTCATCTCGAGATGAAGATGCTTACTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008325.1-308s1c1
Sequence:CCGGGCAGGGACTTATGTACAACTTCTCGAGAAGTTGTACATAAGTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008325.1-1413s1c1
Sequence:CCGGGTACTCTACTTAGACAATCAACTCGAGTTGATTGTCTAAGTAGAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008325.1-506s1c1
Sequence:CCGGACACGTTTCCAAGTGGAACTTCTCGAGAAGTTCCACTTGGAAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-664s21c1
Sequence:CCGGCTGGGTACTTCACGGACTTTGCTCGAGCAAAGTCCGTGAAGTACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-766s21c1
Sequence:CCGGACGTTTCCAAGTGGAACTTTGCTCGAGCAAAGTTCCACTTGGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-1354s21c1
Sequence:CCGGCTCGATTCCAGGTCAACAATACTCGAGTATTGTTGACCTGGAATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008325.3-2108s21c1
Sequence:CCGGCCGAGTTCGAGCATTGGATTACTCGAGTAATCCAATGCTCGAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008325.3-2524s21c1
Sequence:CCGGAGGCTGGGCATGGCAATATATCTCGAGATATATTGCCATGCCCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008325
VALIDATED
IDUA MISSION shRNA Lentiviral Transduction Particles
iduronidase, alpha-L-
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008325.1-2523s1c1
Sequence:CCGGGCACAGAGTAAGCATCTTCATCTCGAGATGAAGATGCTTACTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008325.1-308s1c1
Sequence:CCGGGCAGGGACTTATGTACAACTTCTCGAGAAGTTGTACATAAGTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008325.1-1413s1c1
Sequence:CCGGGTACTCTACTTAGACAATCAACTCGAGTTGATTGTCTAAGTAGAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008325.1-506s1c1
Sequence:CCGGACACGTTTCCAAGTGGAACTTCTCGAGAAGTTCCACTTGGAAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-664s21c1
Sequence:CCGGCTGGGTACTTCACGGACTTTGCTCGAGCAAAGTCCGTGAAGTACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-766s21c1
Sequence:CCGGACGTTTCCAAGTGGAACTTTGCTCGAGCAAAGTTCCACTTGGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008325.3-1354s21c1
Sequence:CCGGCTCGATTCCAGGTCAACAATACTCGAGTATTGTTGACCTGGAATCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008325.3-2108s21c1
Sequence:CCGGCCGAGTTCGAGCATTGGATTACTCGAGTAATCCAATGCTCGAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008325.3-2524s21c1
Sequence:CCGGAGGCTGGGCATGGCAATATATCTCGAGATATATTGCCATGCCCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)