EMAIL THIS PAGE TO A FRIEND

IER2

immediate early response 2

55 Gene Product Result for
Synonyms: ETR101
UniProtKB ID: Q9BTL4, Q03827, Q2TAZ2
Gene ID:
Mouse(15936) immediate early response 2
Rat(494344) immediate early response 2
sheep(101103471) immediate early response 2
domestic guinea pig(101789219) immediate early response 2
naked mole-rat(101725427) immediate early response 2
Zebrafish(797137) immediate early response 2
dog(484917) immediate early response 2
cow(525380) immediate early response 2
domestic cat(101094574) immediate early response 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032251 MISSION® esiRNA esiRNA targeting mouse Ier2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004907 Rosetta Predictions human pricing
NM_001009541 Rosetta Predictions rat pricing
NM_010499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221472 predicted 720
2 SASI_Hs01_00221473 predicted 733
3 SASI_Hs01_00221474 predicted 456
4 SASI_Hs01_00221475 predicted 352
5 SASI_Hs01_00221476 predicted 1165
6 SASI_Hs01_00221477 predicted 1434
7 SASI_Hs02_00338560 predicted 1262
8 SASI_Hs02_00338561 predicted 1438
9 SASI_Hs02_00338562 predicted 1442
10 SASI_Hs02_00338563 predicted 1276
11 SASI_Hs01_00221478 predicted 1853
12 SASI_Hs01_00221479 predicted 1808
13 SASI_Hs01_00221480 predicted 1698
14 SASI_Hs01_00221481 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199602 predicted 621
2 SASI_Rn01_00081285 predicted 1017
3 SASI_Rn01_00081286 predicted 928
4 SASI_Rn01_00081287 predicted 905
5 SASI_Rn01_00081288 predicted 698
6 SASI_Rn01_00081289 predicted 1229
7 SASI_Rn01_00081290 predicted 1001
8 SASI_Rn01_00081291 predicted 460
9 SASI_Rn02_00199603 predicted 615
10 SASI_Rn02_00199604 predicted 950
11 SASI_Rn01_00081292 predicted 231
12 SASI_Rn01_00081293 predicted 561
13 SASI_Rn01_00081294 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188109 predicted 1035
2 SASI_Mm01_00188110 predicted 1021
3 SASI_Mm01_00188111 predicted 469
4 SASI_Mm01_00188112 predicted 719
5 SASI_Mm01_00188113 predicted 949
6 SASI_Mm01_00188114 predicted 1017
7 SASI_Mm01_00188117 predicted 235
8 SASI_Mm02_00318754 predicted 266
9 SASI_Mm02_00318755 predicted 1070
10 SASI_Mm01_00188115 predicted 506
11 SASI_Mm01_00188116 predicted 972
12 SASI_Mm01_00188118 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004907
VALIDATED
IER2 MISSION shRNA Bacterial Glycerol Stock
immediate early response 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-355s21c1
Sequence:CCGGCATCATGACCCTGTCGGTGTGCTCGAGCACACCGACAGGGTCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-729s21c1
Sequence:CCGGGACTGGTCCCGAGCAAGAAAGCTCGAGCTTTCTTGCTCGGGACCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004907.2-1814s21c1
Sequence:CCGGCTGGTCTGAATCACGAGAATGCTCGAGCATTCTCGTGATTCAGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-379s21c1
Sequence:CCGGGATGTATCACTCCCGCATGCACTCGAGTGCATGCGGGAGTGATACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-366s21c1
Sequence:CCGGTGTCGGTGTGGAAGATGTATCCTCGAGGATACATCTTCCACACCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004907.2-1484s1c1
Sequence:CCGGCCTCCGCTGACATACTTGTATCTCGAGATACAAGTATGTCAGCGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1700s1c1
Sequence:CCGGGATCTACTTTCACATTCTCAACTCGAGTTGAGAATGTGAAAGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1703s1c1
Sequence:CCGGCTACTTTCACATTCTCAAGTTCTCGAGAACTTGAGAATGTGAAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1934s1c1
Sequence:CCGGGAGTTTCTGAGGGTCTGCTTTCTCGAGAAAGCAGACCCTCAGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1792s1c1
Sequence:CCGGGACACAATCAGCCGAGAAGTTCTCGAGAACTTCTCGGCTGATTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004907
VALIDATED
IER2 MISSION shRNA shRNA Plasmid DNA
immediate early response 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-355s21c1
Sequence:CCGGCATCATGACCCTGTCGGTGTGCTCGAGCACACCGACAGGGTCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-729s21c1
Sequence:CCGGGACTGGTCCCGAGCAAGAAAGCTCGAGCTTTCTTGCTCGGGACCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004907.2-1814s21c1
Sequence:CCGGCTGGTCTGAATCACGAGAATGCTCGAGCATTCTCGTGATTCAGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-379s21c1
Sequence:CCGGGATGTATCACTCCCGCATGCACTCGAGTGCATGCGGGAGTGATACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-366s21c1
Sequence:CCGGTGTCGGTGTGGAAGATGTATCCTCGAGGATACATCTTCCACACCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004907.2-1484s1c1
Sequence:CCGGCCTCCGCTGACATACTTGTATCTCGAGATACAAGTATGTCAGCGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1700s1c1
Sequence:CCGGGATCTACTTTCACATTCTCAACTCGAGTTGAGAATGTGAAAGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1703s1c1
Sequence:CCGGCTACTTTCACATTCTCAAGTTCTCGAGAACTTGAGAATGTGAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1934s1c1
Sequence:CCGGGAGTTTCTGAGGGTCTGCTTTCTCGAGAAAGCAGACCCTCAGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1792s1c1
Sequence:CCGGGACACAATCAGCCGAGAAGTTCTCGAGAACTTCTCGGCTGATTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004907
VALIDATED
IER2 MISSION shRNA Lentiviral Transduction Particles
immediate early response 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-355s21c1
Sequence:CCGGCATCATGACCCTGTCGGTGTGCTCGAGCACACCGACAGGGTCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-729s21c1
Sequence:CCGGGACTGGTCCCGAGCAAGAAAGCTCGAGCTTTCTTGCTCGGGACCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004907.2-1814s21c1
Sequence:CCGGCTGGTCTGAATCACGAGAATGCTCGAGCATTCTCGTGATTCAGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-379s21c1
Sequence:CCGGGATGTATCACTCCCGCATGCACTCGAGTGCATGCGGGAGTGATACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004907.2-366s21c1
Sequence:CCGGTGTCGGTGTGGAAGATGTATCCTCGAGGATACATCTTCCACACCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004907.2-1484s1c1
Sequence:CCGGCCTCCGCTGACATACTTGTATCTCGAGATACAAGTATGTCAGCGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1700s1c1
Sequence:CCGGGATCTACTTTCACATTCTCAACTCGAGTTGAGAATGTGAAAGTAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1703s1c1
Sequence:CCGGCTACTTTCACATTCTCAAGTTCTCGAGAACTTGAGAATGTGAAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1934s1c1
Sequence:CCGGGAGTTTCTGAGGGTCTGCTTTCTCGAGAAAGCAGACCCTCAGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004907.2-1792s1c1
Sequence:CCGGGACACAATCAGCCGAGAAGTTCTCGAGAACTTCTCGGCTGATTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010499
VALIDATED
IER2 MISSION shRNA Bacterial Glycerol Stock
immediate early response 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010499.4-924s21c1
Sequence:CCGGCGTGCGTCCATAGGTGCTATTCTCGAGAATAGCACCTATGGACGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-474s21c1
Sequence:CCGGAGCGATTTGAGCGACGGTAGTCTCGAGACTACCGTCGCTCAAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-328s21c1
Sequence:CCGGCCGAAGTTGCAGTGGAAGTAGCTCGAGCTACTTCCACTGCAACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-200s21c1
Sequence:CCGGTCTGCAGCTGTCCCTCGTTATCTCGAGATAACGAGGGACAGCTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010499.4-128s21c1
Sequence:CCGGCATCATGACTCTGTCGGTATGCTCGAGCATACCGACAGAGTCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010499.2-1645s1c1
Sequence:CCGGGCCACAAGTTTACCTGCTTAACTCGAGTTAAGCAGGTAAACTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010499.2-1412s1c1
Sequence:CCGGCGTGTTTAAGAAAGTCTGTTTCTCGAGAAACAGACTTTCTTAAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010499.2-147s1c1
Sequence:CCGGGAAGATGTACCACTCTCGCATCTCGAGATGCGAGAGTGGTACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010499
VALIDATED
IER2 MISSION shRNA shRNA Plasmid DNA
immediate early response 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010499.4-924s21c1
Sequence:CCGGCGTGCGTCCATAGGTGCTATTCTCGAGAATAGCACCTATGGACGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-474s21c1
Sequence:CCGGAGCGATTTGAGCGACGGTAGTCTCGAGACTACCGTCGCTCAAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-328s21c1
Sequence:CCGGCCGAAGTTGCAGTGGAAGTAGCTCGAGCTACTTCCACTGCAACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-200s21c1
Sequence:CCGGTCTGCAGCTGTCCCTCGTTATCTCGAGATAACGAGGGACAGCTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010499.4-128s21c1
Sequence:CCGGCATCATGACTCTGTCGGTATGCTCGAGCATACCGACAGAGTCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010499.2-1645s1c1
Sequence:CCGGGCCACAAGTTTACCTGCTTAACTCGAGTTAAGCAGGTAAACTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010499.2-1412s1c1
Sequence:CCGGCGTGTTTAAGAAAGTCTGTTTCTCGAGAAACAGACTTTCTTAAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010499.2-147s1c1
Sequence:CCGGGAAGATGTACCACTCTCGCATCTCGAGATGCGAGAGTGGTACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010499
VALIDATED
IER2 MISSION shRNA Lentiviral Transduction Particles
immediate early response 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010499.4-924s21c1
Sequence:CCGGCGTGCGTCCATAGGTGCTATTCTCGAGAATAGCACCTATGGACGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-474s21c1
Sequence:CCGGAGCGATTTGAGCGACGGTAGTCTCGAGACTACCGTCGCTCAAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-328s21c1
Sequence:CCGGCCGAAGTTGCAGTGGAAGTAGCTCGAGCTACTTCCACTGCAACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010499.4-200s21c1
Sequence:CCGGTCTGCAGCTGTCCCTCGTTATCTCGAGATAACGAGGGACAGCTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010499.4-128s21c1
Sequence:CCGGCATCATGACTCTGTCGGTATGCTCGAGCATACCGACAGAGTCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010499.2-1645s1c1
Sequence:CCGGGCCACAAGTTTACCTGCTTAACTCGAGTTAAGCAGGTAAACTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010499.2-1412s1c1
Sequence:CCGGCGTGTTTAAGAAAGTCTGTTTCTCGAGAAACAGACTTTCTTAAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010499.2-147s1c1
Sequence:CCGGGAAGATGTACCACTCTCGCATCTCGAGATGCGAGAGTGGTACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)