EMAIL THIS PAGE TO A FRIEND

IER3

immediate early response 3

111 Gene Product Result for
Synonyms: DIF-2 DIF2 GLY96 IEX-1 IEX-1L IEX1 PRG1
UniProtKB ID: P46695, Q5SU30, Q92691, Q93044
Gene ID:
Human(8870) Summary: This gene functions in the protection of cells from Fas- or tumor necrosis factor type alpha-induced apoptosis. Partially degraded and unspliced transcripts are found after virus infection in vitro, but these transcripts are not found in vivo and do not generate a valid protein. [provided by RefSeq, Jul 2008]
Mouse(15937) immediate early response 3
Rat(294235) immediate early response 3
dog(481708) immediate early response 3
cow(505455) immediate early response 3
domestic cat(101096476) immediate early response 3
domestic guinea pig(100718433) immediate early response 3
naked mole-rat(101700759) immediate early response 3
sheep(101108867) immediate early response 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003897 Rosetta Predictions human pricing
NM_052815 Rosetta Predictions human pricing
NM_212505 Rosetta Predictions rat pricing
NM_133662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221892 predicted 605
2 SASI_Hs01_00221893 predicted 317
3 SASI_Hs01_00221894 predicted 417
4 SASI_Hs01_00221895 predicted 719
5 SASI_Hs01_00221896 predicted 591
6 SASI_Hs01_00221898 predicted 540
7 SASI_Hs01_00221899 predicted 801
8 SASI_Hs01_00221900 predicted 467
9 SASI_Hs01_00221901 predicted 659
10 SASI_Hs02_00336521 predicted 993
11 SASI_Hs01_00221897 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050294 predicted 980
2 SASI_Hs01_00050295 predicted 717
3 SASI_Hs01_00050296 predicted 528
4 SASI_Hs01_00050297 predicted 704
5 SASI_Hs01_00050298 predicted 895
6 SASI_Hs01_00050299 predicted 912
7 SASI_Hs01_00050300 predicted 906
8 SASI_Hs01_00050301 predicted 652
9 SASI_Hs01_00050302 predicted 904
10 SASI_Hs01_00050303 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270495 predicted 761
2 SASI_Rn01_00034118 predicted 770
3 SASI_Rn01_00034119 predicted 815
4 SASI_Rn01_00034120 predicted 804
5 SASI_Rn01_00034121 predicted 767
6 SASI_Rn01_00034123 predicted 788
7 SASI_Rn01_00034124 predicted 720
8 SASI_Rn01_00034125 predicted 812
9 SASI_Rn01_00034126 predicted 811
10 SASI_Rn01_00034127 predicted 806
11 SASI_Rn01_00034122 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338592 predicted 430
2 SASI_Mm01_00064463 predicted 355
3 SASI_Mm01_00064464 predicted 368
4 SASI_Mm01_00064465 predicted 362
5 SASI_Mm01_00064462 predicted 406
6 SASI_Mm01_00064466 predicted 559
7 SASI_Mm02_00338593 predicted 430
8 SASI_Mm02_00338594 predicted 430
9 SASI_Mm01_00064468 predicted 552
10 SASI_Mm02_00338595 predicted 435
11 SASI_Mm01_00064461 predicted 431
12 SASI_Mm01_00064467 predicted 439
13 SASI_Mm01_00064469 predicted 433
14 SASI_Mm01_00064470 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133662
IER3 MISSION shRNA Bacterial Glycerol Stock
immediate early response 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133662.2-784s21c1
Sequence:CCGGACGATTTATAGGGTCGGTAAGCTCGAGCTTACCGACCCTATAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-271s21c1
Sequence:CCGGCTCCTGTTCGCCATCATCTTCCTCGAGGAAGATGATGGCGAACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-934s1c1
Sequence:CCGGCTTTGGAAGACCCTTGGGAATCTCGAGATTCCCAAGGGTCTTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-153s21c1
Sequence:CCGGCGCGCGTTTGAACACTTCTCGCTCGAGCGAGAAGTGTTCAAACGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-404s21c1
Sequence:CCGGTCGAGCCTTTGAACCTGACCTCTCGAGAGGTCAGGTTCAAAGGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-578s1c1
Sequence:CCGGCAACGCTAACTCAGAACACTACTCGAGTAGTGTTCTGAGTTAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-647s1c1
Sequence:CCGGGAGACTTTCTCCGTGTCTAATCTCGAGATTAGACACGGAGAAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-760s1c2
Sequence:CCGGCCTGCTGTAACACAGATATTTCTCGAGAAATATCTGTGTTACAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-368s21c1
Sequence:CCGGAGCCCATTTCTGCGCCCATTACTCGAGTAATGGGCGCAGAAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133662.2-496s21c1
Sequence:CCGGTGGGTCACAGTCCGAAGAAACCTCGAGGTTTCTTCGGACTGTGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-435s21c1
Sequence:CCGGGGACTATGCGCTGGATCTTAACTCGAGTTAAGATCCAGCGCATAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133662
IER3 MISSION shRNA shRNA Plasmid DNA
immediate early response 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133662.2-784s21c1
Sequence:CCGGACGATTTATAGGGTCGGTAAGCTCGAGCTTACCGACCCTATAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-271s21c1
Sequence:CCGGCTCCTGTTCGCCATCATCTTCCTCGAGGAAGATGATGGCGAACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-934s1c1
Sequence:CCGGCTTTGGAAGACCCTTGGGAATCTCGAGATTCCCAAGGGTCTTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-153s21c1
Sequence:CCGGCGCGCGTTTGAACACTTCTCGCTCGAGCGAGAAGTGTTCAAACGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-404s21c1
Sequence:CCGGTCGAGCCTTTGAACCTGACCTCTCGAGAGGTCAGGTTCAAAGGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-578s1c1
Sequence:CCGGCAACGCTAACTCAGAACACTACTCGAGTAGTGTTCTGAGTTAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-647s1c1
Sequence:CCGGGAGACTTTCTCCGTGTCTAATCTCGAGATTAGACACGGAGAAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-760s1c2
Sequence:CCGGCCTGCTGTAACACAGATATTTCTCGAGAAATATCTGTGTTACAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-368s21c1
Sequence:CCGGAGCCCATTTCTGCGCCCATTACTCGAGTAATGGGCGCAGAAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133662.2-496s21c1
Sequence:CCGGTGGGTCACAGTCCGAAGAAACCTCGAGGTTTCTTCGGACTGTGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-435s21c1
Sequence:CCGGGGACTATGCGCTGGATCTTAACTCGAGTTAAGATCCAGCGCATAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133662
IER3 MISSION shRNA Lentiviral Transduction Particles
immediate early response 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133662.2-784s21c1
Sequence:CCGGACGATTTATAGGGTCGGTAAGCTCGAGCTTACCGACCCTATAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-271s21c1
Sequence:CCGGCTCCTGTTCGCCATCATCTTCCTCGAGGAAGATGATGGCGAACAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-934s1c1
Sequence:CCGGCTTTGGAAGACCCTTGGGAATCTCGAGATTCCCAAGGGTCTTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-153s21c1
Sequence:CCGGCGCGCGTTTGAACACTTCTCGCTCGAGCGAGAAGTGTTCAAACGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-404s21c1
Sequence:CCGGTCGAGCCTTTGAACCTGACCTCTCGAGAGGTCAGGTTCAAAGGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-578s1c1
Sequence:CCGGCAACGCTAACTCAGAACACTACTCGAGTAGTGTTCTGAGTTAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-647s1c1
Sequence:CCGGGAGACTTTCTCCGTGTCTAATCTCGAGATTAGACACGGAGAAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133662.1-760s1c2
Sequence:CCGGCCTGCTGTAACACAGATATTTCTCGAGAAATATCTGTGTTACAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-368s21c1
Sequence:CCGGAGCCCATTTCTGCGCCCATTACTCGAGTAATGGGCGCAGAAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133662.2-496s21c1
Sequence:CCGGTGGGTCACAGTCCGAAGAAACCTCGAGGTTTCTTCGGACTGTGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133662.2-435s21c1
Sequence:CCGGGGACTATGCGCTGGATCTTAACTCGAGTTAAGATCCAGCGCATAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003897
VALIDATED
IER3 MISSION shRNA Bacterial Glycerol Stock
immediate early response 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003897.2-419s1c1
Sequence:CCGGGCCCTTTAATCTGACTTCGGACTCGAGTCCGAAGTCAGATTAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-320s21c1
Sequence:CCGGCCAGATCCTGATGGCTGAAGACTCGAGTCTTCAGCCATCAGGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-1073s1c1
Sequence:CCGGGCGGACCATTAGGAATGAGATCTCGAGATCTCATTCCTAATGGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-727s1c1
Sequence:CCGGGAGAGCGTCGTTAATTTATTTCTCGAGAAATAAATTAACGACGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-602s1c1
Sequence:CCGGCAACTTGAACTCAGAACACTACTCGAGTAGTGTTCTGAGTTCAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-797s1c1
Sequence:CCGGGTGATGGAGATGTGTACGTAACTCGAGTTACGTACACATCTCCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003897.2-416s1c1
Sequence:CCGGCGAGCCCTTTAATCTGACTTCCTCGAGGAAGTCAGATTAAAGGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-928s1c1
Sequence:CCGGGCGGCAAAGTAGGAGAAGAAACTCGAGTTTCTTCTCCTACTTTGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-597s1c1
Sequence:CCGGCGAGGCAACTTGAACTCAGAACTCGAGTTCTGAGTTCAAGTTGCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-792s1c1
Sequence:CCGGCCTAGGTGATGGAGATGTGTACTCGAGTACACATCTCCATCACCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003897.3-467s21c1
Sequence:CCGGCAGCACTTTCCTCCAGCAACACTCGAGTGTTGCTGGAGGAAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-296s21c1
Sequence:CCGGTCTGCTGCTCACCATCGTCTTCTCGAGAAGACGATGGTGAGCAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-126s21c1
Sequence:CCGGGGTCCTGAGATCTTCACCTTCCTCGAGGAAGGTGAAGATCTCAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003897
VALIDATED
IER3 MISSION shRNA shRNA Plasmid DNA
immediate early response 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003897.2-419s1c1
Sequence:CCGGGCCCTTTAATCTGACTTCGGACTCGAGTCCGAAGTCAGATTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-320s21c1
Sequence:CCGGCCAGATCCTGATGGCTGAAGACTCGAGTCTTCAGCCATCAGGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-1073s1c1
Sequence:CCGGGCGGACCATTAGGAATGAGATCTCGAGATCTCATTCCTAATGGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-727s1c1
Sequence:CCGGGAGAGCGTCGTTAATTTATTTCTCGAGAAATAAATTAACGACGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-602s1c1
Sequence:CCGGCAACTTGAACTCAGAACACTACTCGAGTAGTGTTCTGAGTTCAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-797s1c1
Sequence:CCGGGTGATGGAGATGTGTACGTAACTCGAGTTACGTACACATCTCCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003897.2-416s1c1
Sequence:CCGGCGAGCCCTTTAATCTGACTTCCTCGAGGAAGTCAGATTAAAGGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-928s1c1
Sequence:CCGGGCGGCAAAGTAGGAGAAGAAACTCGAGTTTCTTCTCCTACTTTGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-597s1c1
Sequence:CCGGCGAGGCAACTTGAACTCAGAACTCGAGTTCTGAGTTCAAGTTGCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-792s1c1
Sequence:CCGGCCTAGGTGATGGAGATGTGTACTCGAGTACACATCTCCATCACCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003897.3-467s21c1
Sequence:CCGGCAGCACTTTCCTCCAGCAACACTCGAGTGTTGCTGGAGGAAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-296s21c1
Sequence:CCGGTCTGCTGCTCACCATCGTCTTCTCGAGAAGACGATGGTGAGCAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-126s21c1
Sequence:CCGGGGTCCTGAGATCTTCACCTTCCTCGAGGAAGGTGAAGATCTCAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003897
VALIDATED
IER3 MISSION shRNA Lentiviral Transduction Particles
immediate early response 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003897.2-419s1c1
Sequence:CCGGGCCCTTTAATCTGACTTCGGACTCGAGTCCGAAGTCAGATTAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-320s21c1
Sequence:CCGGCCAGATCCTGATGGCTGAAGACTCGAGTCTTCAGCCATCAGGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-1073s1c1
Sequence:CCGGGCGGACCATTAGGAATGAGATCTCGAGATCTCATTCCTAATGGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-727s1c1
Sequence:CCGGGAGAGCGTCGTTAATTTATTTCTCGAGAAATAAATTAACGACGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-602s1c1
Sequence:CCGGCAACTTGAACTCAGAACACTACTCGAGTAGTGTTCTGAGTTCAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-797s1c1
Sequence:CCGGGTGATGGAGATGTGTACGTAACTCGAGTTACGTACACATCTCCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003897.2-416s1c1
Sequence:CCGGCGAGCCCTTTAATCTGACTTCCTCGAGGAAGTCAGATTAAAGGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-928s1c1
Sequence:CCGGGCGGCAAAGTAGGAGAAGAAACTCGAGTTTCTTCTCCTACTTTGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003897.2-597s1c1
Sequence:CCGGCGAGGCAACTTGAACTCAGAACTCGAGTTCTGAGTTCAAGTTGCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003897.2-792s1c1
Sequence:CCGGCCTAGGTGATGGAGATGTGTACTCGAGTACACATCTCCATCACCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003897.3-467s21c1
Sequence:CCGGCAGCACTTTCCTCCAGCAACACTCGAGTGTTGCTGGAGGAAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-296s21c1
Sequence:CCGGTCTGCTGCTCACCATCGTCTTCTCGAGAAGACGATGGTGAGCAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003897.3-126s21c1
Sequence:CCGGGGTCCTGAGATCTTCACCTTCCTCGAGGAAGGTGAAGATCTCAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)