EMAIL THIS PAGE TO A FRIEND

IER3IP1

immediate early response 3 interacting protein 1

52 Gene Product Result for
Synonyms: MEDS PRO2309
UniProtKB ID: Q9Y5U9
Gene ID:
Human(51124) Summary: This gene encodes a small protein that is localized to the endoplasmic reticulum (ER) and may play a role in the ER stress response by mediating cell differentiation and apoptosis. Transcription of this gene is regulated by tumor necrosis factor alpha and specificity protein 1 (Sp1). Mutations in this gene may play a role in microcephaly, epilepsy, and diabetes syndrome (MEDS), and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Dec 2011]
Mouse(66191) immediate early response 3 interacting protein 1
Goat(100861016) immediate early response 3 interacting protein 1
domestic guinea pig(100727238) immediate early response 3 interacting protein 1
naked mole-rat(101712886) immediate early response 3 interacting protein 1
Zebrafish(554110) immediate early response 3 interacting protein 1
cow(768079) immediate early response 3 interacting protein 1
domestic cat(101086429) immediate early response 3 interacting protein 1
dog(612379) immediate early response 3 interacting protein 1
chicken(101749130) immediate early response 3 interacting protein 1
chicken(101666892) immediate early response 3 interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA010027 Anti-IER3IP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106761 Anti-IER3IP1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, human, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016097 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016097 Rosetta Predictions human pricing
NM_025409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348861 predicted 798
2 SASI_Hs02_00348862 predicted 798
3 SASI_Hs01_00136765 predicted 247
4 SASI_Hs02_00348863 predicted 221
5 SASI_Hs01_00136766 predicted 250
6 SASI_Hs02_00348864 predicted 197
7 SASI_Hs02_00348865 predicted 243
8 SASI_Hs02_00348866 predicted 245
9 SASI_Hs01_00136767 predicted 773
10 SASI_Hs01_00136769 predicted 231
11 SASI_Hs01_00136764 predicted 773
12 SASI_Hs01_00136768 predicted 229
13 SASI_Hs01_00136770 predicted 232
14 SASI_Hs01_00136771 predicted 704
15 SASI_Hs01_00136772 predicted 250
16 SASI_Hs01_00136773 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328160 predicted 827
2 SASI_Mm02_00328161 predicted 737
3 SASI_Mm02_00328162 predicted 207
4 SASI_Mm02_00328163 predicted 743
5 SASI_Mm02_00328164 predicted 802
6 SASI_Mm02_00328165 predicted 780
7 SASI_Mm02_00328166 predicted 780
8 SASI_Mm02_00328167 predicted 720
9 SASI_Mm02_00328168 predicted 689
10 SASI_Mm02_00328169 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016097
VALIDATED
IER3IP1 MISSION shRNA Bacterial Glycerol Stock
immediate early response 3 interacting protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016097.3-220s21c1
Sequence:CCGGATTTGGAGAAGAGCCGGGAATCTCGAGATTCCCGGCTCTTCTCCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016097.3-298s21c1
Sequence:CCGCGATAATAGTAAACTCAATTGCCTCGAGGCAATTGAGTTTACTATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016097.3-675s21c1
Sequence:CCGGCTCACTTCTCAGGGATGAAATCTCGAGATTTCATCCCTGAGAAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016097.3-512s21c1
Sequence:CCGGGTTGCACTTGTAGTTTCATTACTCGAGTAATGAAACTACAAGTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016097.2-252s1c1
Sequence:CCGGGATGAGAGTGCCATTGATAATCTCGAGATTATCAATGGCACTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016097.2-1287s1c1
Sequence:CCGGCTTGTGAGATTGTTTGCCTATCTCGAGATAGGCAAACAATCTCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-1302s1c1
Sequence:CCGGGCCTATCTCATAATACAGTTTCTCGAGAAACTGTATTATGAGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016097.2-203s1c1
Sequence:CCGGCGGGAATTAAATCACAGCTAACTCGAGTTAGCTGTGATTTAATTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016097.2-202s1c1
Sequence:CCGGCCGGGAATTAAATCACAGCTACTCGAGTAGCTGTGATTTAATTCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016097.2-236s1c1
Sequence:CCGGGATCTGTAAGAACCGTGATGACTCGAGTCATCACGGTTCTTACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-534s1c1
Sequence:CCGGCCAGGACTGGAATATCTGATTCTCGAGAATCAGATATTCCAGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016097.2-201s1c1
Sequence:CCGGGCCGGGAATTAAATCACAGCTCTCGAGAGCTGTGATTTAATTCCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016097.2-141s1c1
Sequence:CCGGGCGATTCCTCAAGAACATTGGCTCGAGCCAATGTTCTTGAGGAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-603s1c1
Sequence:CCGGGCAAGACTGTTGCTTCTCTTTCTCGAGAAAGAGAAGCAACAGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016097
VALIDATED
IER3IP1 MISSION shRNA shRNA Plasmid DNA
immediate early response 3 interacting protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016097.3-220s21c1
Sequence:CCGGATTTGGAGAAGAGCCGGGAATCTCGAGATTCCCGGCTCTTCTCCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016097.3-298s21c1
Sequence:CCGCGATAATAGTAAACTCAATTGCCTCGAGGCAATTGAGTTTACTATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016097.3-675s21c1
Sequence:CCGGCTCACTTCTCAGGGATGAAATCTCGAGATTTCATCCCTGAGAAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016097.3-512s21c1
Sequence:CCGGGTTGCACTTGTAGTTTCATTACTCGAGTAATGAAACTACAAGTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016097.2-252s1c1
Sequence:CCGGGATGAGAGTGCCATTGATAATCTCGAGATTATCAATGGCACTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016097.2-1287s1c1
Sequence:CCGGCTTGTGAGATTGTTTGCCTATCTCGAGATAGGCAAACAATCTCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-1302s1c1
Sequence:CCGGGCCTATCTCATAATACAGTTTCTCGAGAAACTGTATTATGAGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016097.2-203s1c1
Sequence:CCGGCGGGAATTAAATCACAGCTAACTCGAGTTAGCTGTGATTTAATTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016097.2-202s1c1
Sequence:CCGGCCGGGAATTAAATCACAGCTACTCGAGTAGCTGTGATTTAATTCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016097.2-236s1c1
Sequence:CCGGGATCTGTAAGAACCGTGATGACTCGAGTCATCACGGTTCTTACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-534s1c1
Sequence:CCGGCCAGGACTGGAATATCTGATTCTCGAGAATCAGATATTCCAGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016097.2-201s1c1
Sequence:CCGGGCCGGGAATTAAATCACAGCTCTCGAGAGCTGTGATTTAATTCCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016097.2-141s1c1
Sequence:CCGGGCGATTCCTCAAGAACATTGGCTCGAGCCAATGTTCTTGAGGAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-603s1c1
Sequence:CCGGGCAAGACTGTTGCTTCTCTTTCTCGAGAAAGAGAAGCAACAGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016097
VALIDATED
IER3IP1 MISSION shRNA Lentiviral Transduction Particles
immediate early response 3 interacting protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016097.3-220s21c1
Sequence:CCGGATTTGGAGAAGAGCCGGGAATCTCGAGATTCCCGGCTCTTCTCCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016097.3-298s21c1
Sequence:CCGCGATAATAGTAAACTCAATTGCCTCGAGGCAATTGAGTTTACTATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016097.3-675s21c1
Sequence:CCGGCTCACTTCTCAGGGATGAAATCTCGAGATTTCATCCCTGAGAAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016097.3-512s21c1
Sequence:CCGGGTTGCACTTGTAGTTTCATTACTCGAGTAATGAAACTACAAGTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016097.2-252s1c1
Sequence:CCGGGATGAGAGTGCCATTGATAATCTCGAGATTATCAATGGCACTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016097.2-1287s1c1
Sequence:CCGGCTTGTGAGATTGTTTGCCTATCTCGAGATAGGCAAACAATCTCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-1302s1c1
Sequence:CCGGGCCTATCTCATAATACAGTTTCTCGAGAAACTGTATTATGAGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016097.2-203s1c1
Sequence:CCGGCGGGAATTAAATCACAGCTAACTCGAGTTAGCTGTGATTTAATTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016097.2-202s1c1
Sequence:CCGGCCGGGAATTAAATCACAGCTACTCGAGTAGCTGTGATTTAATTCCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016097.2-236s1c1
Sequence:CCGGGATCTGTAAGAACCGTGATGACTCGAGTCATCACGGTTCTTACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-534s1c1
Sequence:CCGGCCAGGACTGGAATATCTGATTCTCGAGAATCAGATATTCCAGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016097.2-201s1c1
Sequence:CCGGGCCGGGAATTAAATCACAGCTCTCGAGAGCTGTGATTTAATTCCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016097.2-141s1c1
Sequence:CCGGGCGATTCCTCAAGAACATTGGCTCGAGCCAATGTTCTTGAGGAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016097.2-603s1c1
Sequence:CCGGGCAAGACTGTTGCTTCTCTTTCTCGAGAAAGAGAAGCAACAGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025409
VALIDATED
IER3IP1 MISSION shRNA Bacterial Glycerol Stock
immediate early response 3 interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-739s21c1
Sequence:CCGGCTAGTTGACAAATTGGTATTTCTCGAGAAATACCAATTTGTCAACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-220s21c1
Sequence:CCGGCCAGGAATTAAATCTCAACTACTCGAGTAGTTGAGATTTAATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-319s21c1
Sequence:CCGGCTGTTATTTGGCTGAACATCGCTCGAGCGATGTTCAGCCAAATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-277s21c1
Sequence:CCGGGTGCCATTGATAATAGTAAACCTCGAGGTTTACTATTATCAATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-190s21c1
Sequence:CCGGGACCAGGGAATCGGTGGATTTCTCGAGAAATCCACCGATTCCCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-220s1c1
Sequence:CCGGCCAGGAATTAAATCTCAACTACTCGAGTAGTTGAGATTTAATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-835s1c1
Sequence:CCGGGCCGTGATTTCAGAGAGAATTCTCGAGAATTCTCTCTGAAATCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-190s1c1
Sequence:CCGGGACCAGGGAATCGGTGGATTTCTCGAGAAATCCACCGATTCCCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025409.1-252s1c1
Sequence:CCGGTCGGTCTGTAAGAACCGTGATCTCGAGATCACGGTTCTTACAGACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-242s1c1
Sequence:CCGGTGAACCTTATTCGGTCTGTAACTCGAGTTACAGACCGAATAAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025409
VALIDATED
IER3IP1 MISSION shRNA shRNA Plasmid DNA
immediate early response 3 interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-739s21c1
Sequence:CCGGCTAGTTGACAAATTGGTATTTCTCGAGAAATACCAATTTGTCAACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-220s21c1
Sequence:CCGGCCAGGAATTAAATCTCAACTACTCGAGTAGTTGAGATTTAATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-319s21c1
Sequence:CCGGCTGTTATTTGGCTGAACATCGCTCGAGCGATGTTCAGCCAAATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-277s21c1
Sequence:CCGGGTGCCATTGATAATAGTAAACCTCGAGGTTTACTATTATCAATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-190s21c1
Sequence:CCGGGACCAGGGAATCGGTGGATTTCTCGAGAAATCCACCGATTCCCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-220s1c1
Sequence:CCGGCCAGGAATTAAATCTCAACTACTCGAGTAGTTGAGATTTAATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-835s1c1
Sequence:CCGGGCCGTGATTTCAGAGAGAATTCTCGAGAATTCTCTCTGAAATCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-190s1c1
Sequence:CCGGGACCAGGGAATCGGTGGATTTCTCGAGAAATCCACCGATTCCCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025409.1-252s1c1
Sequence:CCGGTCGGTCTGTAAGAACCGTGATCTCGAGATCACGGTTCTTACAGACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-242s1c1
Sequence:CCGGTGAACCTTATTCGGTCTGTAACTCGAGTTACAGACCGAATAAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025409
VALIDATED
IER3IP1 MISSION shRNA Lentiviral Transduction Particles
immediate early response 3 interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-739s21c1
Sequence:CCGGCTAGTTGACAAATTGGTATTTCTCGAGAAATACCAATTTGTCAACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-220s21c1
Sequence:CCGGCCAGGAATTAAATCTCAACTACTCGAGTAGTTGAGATTTAATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-319s21c1
Sequence:CCGGCTGTTATTTGGCTGAACATCGCTCGAGCGATGTTCAGCCAAATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-277s21c1
Sequence:CCGGGTGCCATTGATAATAGTAAACCTCGAGGTTTACTATTATCAATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025409.2-190s21c1
Sequence:CCGGGACCAGGGAATCGGTGGATTTCTCGAGAAATCCACCGATTCCCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-220s1c1
Sequence:CCGGCCAGGAATTAAATCTCAACTACTCGAGTAGTTGAGATTTAATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-835s1c1
Sequence:CCGGGCCGTGATTTCAGAGAGAATTCTCGAGAATTCTCTCTGAAATCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-190s1c1
Sequence:CCGGGACCAGGGAATCGGTGGATTTCTCGAGAAATCCACCGATTCCCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025409.1-252s1c1
Sequence:CCGGTCGGTCTGTAAGAACCGTGATCTCGAGATCACGGTTCTTACAGACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025409.1-242s1c1
Sequence:CCGGTGAACCTTATTCGGTCTGTAACTCGAGTTACAGACCGAATAAGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)