EMAIL THIS PAGE TO A FRIEND

IER5

immediate early response 5

105 Gene Product Result for
Synonyms: SBBI48
UniProtKB ID: Q5VY09, B2RBV3, Q8WY68, Q9NY49, Q9NZP9
Gene ID:
Human(51278) Summary: This gene encodes a protein that is similar to other immediate early response proteins. In the mouse, a similar gene may play an important role in mediating the cellular response to mitogenic signals. Studies in rats found the expression of a similar gene to be increased after waking and sleep deprivation. [provided by RefSeq, Jul 2008]
Mouse(15939) immediate early response 5
Rat(498256) immediate early response 5
Zebrafish(359827) immediate early response 5
cow(523618) immediate early response 5
chicken(101668887) immediate early response 5
chicken(101750986) immediate early response 5
domestic guinea pig(100713125) immediate early response 5
naked mole-rat(101700792) immediate early response 5
sheep(101120181) immediate early response 5
sheep(100885763) immediate early response 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016545 Rosetta Predictions human pricing
NM_001025137 Rosetta Predictions rat pricing
NM_010500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107733 predicted 1852
2 SASI_Hs01_00107734 predicted 1630
3 SASI_Hs01_00107735 predicted 1623
4 SASI_Hs01_00107736 predicted 1461
5 SASI_Hs01_00107740 predicted 1631
6 SASI_Hs02_00349661 predicted 1558
7 SASI_Hs01_00107737 predicted 1877
8 SASI_Hs01_00107738 predicted 1572
9 SASI_Hs02_00349662 predicted 432
10 SASI_Hs01_00107739 predicted 420
11 SASI_Hs01_00107741 predicted 1534
12 SASI_Hs01_00107742 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078010 predicted 1541
2 SASI_Rn01_00078011 predicted 1546
3 SASI_Rn01_00078012 predicted 1382
4 SASI_Rn01_00078013 predicted 1329
5 SASI_Rn02_00203062 predicted 1360
6 SASI_Rn01_00078015 predicted 1304
7 SASI_Rn02_00203063 predicted 1054
8 SASI_Rn01_00078017 predicted 1216
9 SASI_Rn01_00078019 predicted 278
10 SASI_Rn02_00203064 predicted 931
11 SASI_Rn01_00078014 predicted 983
12 SASI_Rn01_00078016 predicted 671
13 SASI_Rn01_00078018 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318756 predicted 1630
2 SASI_Mm01_00097384 predicted 1383
3 SASI_Mm01_00097385 predicted 1348
4 SASI_Mm01_00097386 predicted 1324
5 SASI_Mm01_00097387 predicted 1375
6 SASI_Mm01_00097388 predicted 1315
7 SASI_Mm02_00318757 predicted 1397
8 SASI_Mm02_00318758 predicted 1300
9 SASI_Mm01_00097391 predicted 1423
10 SASI_Mm01_00097392 predicted 955
11 SASI_Mm01_00097389 predicted 1562
12 SASI_Mm01_00097390 predicted 1402
13 SASI_Mm01_00097393 predicted 1636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010500
IER5 MISSION shRNA Bacterial Glycerol Stock
immediate early response 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010500.2-2648s21c1
Sequence:CCGGCCATCACTGTGGCCCAATATACTCGAGTATATTGGGCCACAGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-302s21c1
Sequence:CCGGGAACCTCTTGGTGTCGTTGGTCTCGAGACCAACGACACCAAGAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-978s21c1
Sequence:CCGGTTCTCGGGACTCCTACGGAAACTCGAGTTTCCGTAGGAGTCCCGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-245s21c1
Sequence:CCGGCTCCCTGGGCAAGATCTACAACTCGAGTTGTAGATCTTGCCCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-955s21c1
Sequence:CCGGTCATCAGCATCTTCGGGTCTACTCGAGTAGACCCGAAGATGCTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010500.1-1325s1c1
Sequence:CCGGGACCTAGAGTTGGAGGCTTATCTCGAGATAAGCCTCCAACTCTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010500.1-290s1c1
Sequence:CCGGCAAGCTGCACAAGAACCTCTTCTCGAGAAGAGGTTCTTGTGCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010500
IER5 MISSION shRNA shRNA Plasmid DNA
immediate early response 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010500.2-2648s21c1
Sequence:CCGGCCATCACTGTGGCCCAATATACTCGAGTATATTGGGCCACAGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-302s21c1
Sequence:CCGGGAACCTCTTGGTGTCGTTGGTCTCGAGACCAACGACACCAAGAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-978s21c1
Sequence:CCGGTTCTCGGGACTCCTACGGAAACTCGAGTTTCCGTAGGAGTCCCGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-245s21c1
Sequence:CCGGCTCCCTGGGCAAGATCTACAACTCGAGTTGTAGATCTTGCCCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-955s21c1
Sequence:CCGGTCATCAGCATCTTCGGGTCTACTCGAGTAGACCCGAAGATGCTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010500.1-1325s1c1
Sequence:CCGGGACCTAGAGTTGGAGGCTTATCTCGAGATAAGCCTCCAACTCTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010500.1-290s1c1
Sequence:CCGGCAAGCTGCACAAGAACCTCTTCTCGAGAAGAGGTTCTTGTGCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010500
IER5 MISSION shRNA Lentiviral Transduction Particles
immediate early response 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010500.2-2648s21c1
Sequence:CCGGCCATCACTGTGGCCCAATATACTCGAGTATATTGGGCCACAGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-302s21c1
Sequence:CCGGGAACCTCTTGGTGTCGTTGGTCTCGAGACCAACGACACCAAGAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-978s21c1
Sequence:CCGGTTCTCGGGACTCCTACGGAAACTCGAGTTTCCGTAGGAGTCCCGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-245s21c1
Sequence:CCGGCTCCCTGGGCAAGATCTACAACTCGAGTTGTAGATCTTGCCCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010500.2-955s21c1
Sequence:CCGGTCATCAGCATCTTCGGGTCTACTCGAGTAGACCCGAAGATGCTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010500.1-1325s1c1
Sequence:CCGGGACCTAGAGTTGGAGGCTTATCTCGAGATAAGCCTCCAACTCTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010500.1-290s1c1
Sequence:CCGGCAAGCTGCACAAGAACCTCTTCTCGAGAAGAGGTTCTTGTGCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016545
IER5 MISSION shRNA Bacterial Glycerol Stock
immediate early response 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016545.3-442s1c1
Sequence:CCGGCTCTGGGCAAGATCTACAACTCTCGAGAGTTGTAGATCTTGCCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-2203s1c1
Sequence:CCGGGACTCCAGTCTTTGTTGTATACTCGAGTATACAACAAAGACTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-2055s1c1
Sequence:CCGGGCTTGGAAATAATGGAGTTTACTCGAGTAAACTCCATTATTTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-1895s1c1
Sequence:CCGGCCAAGAGCACAGACTTGGATTCTCGAGAATCCAAGTCTGTGCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016545.3-437s1c1
Sequence:CCGGCATCTCTCTGGGCAAGATCTACTCGAGTAGATCTTGCCCAGAGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016545
IER5 MISSION shRNA shRNA Plasmid DNA
immediate early response 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016545.3-442s1c1
Sequence:CCGGCTCTGGGCAAGATCTACAACTCTCGAGAGTTGTAGATCTTGCCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-2203s1c1
Sequence:CCGGGACTCCAGTCTTTGTTGTATACTCGAGTATACAACAAAGACTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-2055s1c1
Sequence:CCGGGCTTGGAAATAATGGAGTTTACTCGAGTAAACTCCATTATTTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-1895s1c1
Sequence:CCGGCCAAGAGCACAGACTTGGATTCTCGAGAATCCAAGTCTGTGCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016545.3-437s1c1
Sequence:CCGGCATCTCTCTGGGCAAGATCTACTCGAGTAGATCTTGCCCAGAGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016545
IER5 MISSION shRNA Lentiviral Transduction Particles
immediate early response 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016545.3-442s1c1
Sequence:CCGGCTCTGGGCAAGATCTACAACTCTCGAGAGTTGTAGATCTTGCCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-2203s1c1
Sequence:CCGGGACTCCAGTCTTTGTTGTATACTCGAGTATACAACAAAGACTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-2055s1c1
Sequence:CCGGGCTTGGAAATAATGGAGTTTACTCGAGTAAACTCCATTATTTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016545.3-1895s1c1
Sequence:CCGGCCAAGAGCACAGACTTGGATTCTCGAGAATCCAAGTCTGTGCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016545.3-437s1c1
Sequence:CCGGCATCTCTCTGGGCAAGATCTACTCGAGTAGATCTTGCCCAGAGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)