EMAIL THIS PAGE TO A FRIEND

IER5L

immediate early response 5-like

93 Gene Product Result for
Synonyms: bA247A12.2
UniProtKB ID: Q5T953, Q6P3E2
Gene ID:
Mouse(72500) immediate early response 5-like
Rat(499772) immediate early response 5-like
sheep(101105148) immediate early response 5-like
domestic guinea pig(100714854) immediate early response 5-like
naked mole-rat(101705282) immediate early response 5-like
Zebrafish(326935) immediate early response 5-like
cow(782019) immediate early response 5-like
dog(491302) immediate early response 5-like
domestic cat(101094800) immediate early response 5-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203434 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103901 MISSION® esiRNA esiRNA human AL158151.16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203434 Rosetta Predictions human pricing
NM_001025041 Rosetta Predictions rat pricing
XM_001079588 Rosetta Predictions rat pricing
NM_030244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373358 predicted 1634
2 SASI_Hs02_00373359 predicted 463
3 SASI_Hs02_00373360 predicted 1631
4 SASI_Hs02_00373361 predicted 1098
5 SASI_Hs02_00373362 predicted 1825
6 SASI_Hs02_00373363 predicted 1899
7 SASI_Hs02_00373364 predicted 1636
8 SASI_Hs02_00373365 predicted 466
9 SASI_Hs02_00373366 predicted 941
10 SASI_Hs02_00373367 predicted 1836
11 SASI_Hs01_00092938 predicted 971
12 SASI_Hs01_00092939 predicted 973
13 SASI_Hs01_00092940 predicted 231
14 SASI_Hs01_00092941 predicted 1030
15 SASI_Hs01_00092942 predicted 887
16 SASI_Hs01_00092943 predicted 879
17 SASI_Hs01_00092944 predicted 890
18 SASI_Hs01_00092945 predicted 210
19 SASI_Hs01_00092946 predicted 712
20 SASI_Hs01_00092947 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067195 predicted 1101
2 SASI_Rn01_00067196 predicted 1251
3 SASI_Rn01_00067197 predicted 1119
4 SASI_Rn01_00067198 predicted 1245
5 SASI_Rn02_00202967 predicted 988
6 SASI_Rn01_00067200 predicted 1246
7 SASI_Rn01_00067201 predicted 1100
8 SASI_Rn02_00202968 predicted 1249
9 SASI_Rn01_00067202 predicted 1259
10 SASI_Rn02_00202969 predicted 1103
11 SASI_Rn01_00067194 predicted 1095
12 SASI_Rn01_00067199 predicted 1339
13 SASI_Rn01_00067203 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364779 predicted 1025
2 SASI_Rn02_00364780 predicted 1175
3 SASI_Rn02_00364781 predicted 1040
4 SASI_Rn02_00364782 predicted 1018
5 SASI_Rn02_00364783 predicted 1178
6 SASI_Rn02_00364784 predicted 1027
7 SASI_Rn02_00364785 predicted 914
8 SASI_Rn02_00364786 predicted 1535
9 SASI_Rn02_00364787 predicted 473
10 SASI_Rn02_00364788 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036921 predicted 1085
2 SASI_Mm01_00036922 predicted 1080
3 SASI_Mm01_00036923 predicted 1241
4 SASI_Mm01_00036924 predicted 1101
5 SASI_Mm01_00036925 predicted 1229
6 SASI_Mm01_00036930 predicted 1088
7 SASI_Mm01_00036926 predicted 1233
8 SASI_Mm01_00036927 predicted 1236
9 SASI_Mm01_00036928 predicted 1085
10 SASI_Mm02_00336709 predicted 1087
11 SASI_Mm01_00036929 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030244
IER5L MISSION shRNA Bacterial Glycerol Stock
immediate early response 5-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1388s21c1
Sequence:CCGGTCGAGCCATTGTCGCCTTCTACTCGAGTAGAAGGCGACAATGGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1090s21c1
Sequence:CCGGCTGGTTGCAAGCGCAAGTATTCTCGAGAATACTTGCGCTTGCAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-982s21c1
Sequence:CCGGACGTGGTGACCACGGTAGAAACTCGAGTTTCTACCGTGGTCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-266s21c1
Sequence:CCGGCGGCATCAAGCTGCACAAGAACTCGAGTTCTTGTGCAGCTTGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1239s21c1
Sequence:CCGGGACGCGTCCAACATCTCAAACCTCGAGGTTTGAGATGTTGGACGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030244.2-1828s1c1
Sequence:CCGGCCGATTCTAATCAGTTGTCAACTCGAGTTGACAACTGATTAGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030244.2-1273s1c1
Sequence:CCGGCATCTCAAACTTGATCTCCATCTCGAGATGGAGATCAAGTTTGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030244.2-1269s1c1
Sequence:CCGGCCAACATCTCAAACTTGATCTCTCGAGAGATCAAGTTTGAGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030244
IER5L MISSION shRNA shRNA Plasmid DNA
immediate early response 5-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1388s21c1
Sequence:CCGGTCGAGCCATTGTCGCCTTCTACTCGAGTAGAAGGCGACAATGGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1090s21c1
Sequence:CCGGCTGGTTGCAAGCGCAAGTATTCTCGAGAATACTTGCGCTTGCAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-982s21c1
Sequence:CCGGACGTGGTGACCACGGTAGAAACTCGAGTTTCTACCGTGGTCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-266s21c1
Sequence:CCGGCGGCATCAAGCTGCACAAGAACTCGAGTTCTTGTGCAGCTTGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1239s21c1
Sequence:CCGGGACGCGTCCAACATCTCAAACCTCGAGGTTTGAGATGTTGGACGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030244.2-1828s1c1
Sequence:CCGGCCGATTCTAATCAGTTGTCAACTCGAGTTGACAACTGATTAGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030244.2-1273s1c1
Sequence:CCGGCATCTCAAACTTGATCTCCATCTCGAGATGGAGATCAAGTTTGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030244.2-1269s1c1
Sequence:CCGGCCAACATCTCAAACTTGATCTCTCGAGAGATCAAGTTTGAGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030244
IER5L MISSION shRNA Lentiviral Transduction Particles
immediate early response 5-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1388s21c1
Sequence:CCGGTCGAGCCATTGTCGCCTTCTACTCGAGTAGAAGGCGACAATGGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1090s21c1
Sequence:CCGGCTGGTTGCAAGCGCAAGTATTCTCGAGAATACTTGCGCTTGCAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-982s21c1
Sequence:CCGGACGTGGTGACCACGGTAGAAACTCGAGTTTCTACCGTGGTCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-266s21c1
Sequence:CCGGCGGCATCAAGCTGCACAAGAACTCGAGTTCTTGTGCAGCTTGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030244.3-1239s21c1
Sequence:CCGGGACGCGTCCAACATCTCAAACCTCGAGGTTTGAGATGTTGGACGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030244.2-1828s1c1
Sequence:CCGGCCGATTCTAATCAGTTGTCAACTCGAGTTGACAACTGATTAGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030244.2-1273s1c1
Sequence:CCGGCATCTCAAACTTGATCTCCATCTCGAGATGGAGATCAAGTTTGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030244.2-1269s1c1
Sequence:CCGGCCAACATCTCAAACTTGATCTCTCGAGAGATCAAGTTTGAGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203434
VALIDATED
IER5L MISSION shRNA Bacterial Glycerol Stock
immediate early response 5-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1403s21c1
Sequence:CCGGTCGAGCCATTGTCGCCTTCTACTCGAGTAGAAGGCGACAATGGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203434.2-982s21c1
Sequence:CCGGACCTAGACACTCACGTGGTGACTCGAGTCACCACGTGAGTGTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1103s21c1
Sequence:CCGGCGGCTGCAAGCGCAAGTATTACTCGAGTAATACTTGCGCTTGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203434.2-1963s21c1
Sequence:CCGGAGGGACGTTTGGGTCACATTTCTCGAGAAATGTGACCCAAACGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1254s21c1
Sequence:CCGGGACGCGTCCAACATCTCAAACCTCGAGGTTTGAGATGTTGGACGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203434
VALIDATED
IER5L MISSION shRNA shRNA Plasmid DNA
immediate early response 5-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1403s21c1
Sequence:CCGGTCGAGCCATTGTCGCCTTCTACTCGAGTAGAAGGCGACAATGGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203434.2-982s21c1
Sequence:CCGGACCTAGACACTCACGTGGTGACTCGAGTCACCACGTGAGTGTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1103s21c1
Sequence:CCGGCGGCTGCAAGCGCAAGTATTACTCGAGTAATACTTGCGCTTGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203434.2-1963s21c1
Sequence:CCGGAGGGACGTTTGGGTCACATTTCTCGAGAAATGTGACCCAAACGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1254s21c1
Sequence:CCGGGACGCGTCCAACATCTCAAACCTCGAGGTTTGAGATGTTGGACGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203434
VALIDATED
IER5L MISSION shRNA Lentiviral Transduction Particles
immediate early response 5-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1403s21c1
Sequence:CCGGTCGAGCCATTGTCGCCTTCTACTCGAGTAGAAGGCGACAATGGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203434.2-982s21c1
Sequence:CCGGACCTAGACACTCACGTGGTGACTCGAGTCACCACGTGAGTGTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1103s21c1
Sequence:CCGGCGGCTGCAAGCGCAAGTATTACTCGAGTAATACTTGCGCTTGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203434.2-1963s21c1
Sequence:CCGGAGGGACGTTTGGGTCACATTTCTCGAGAAATGTGACCCAAACGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_203434.2-1254s21c1
Sequence:CCGGGACGCGTCCAACATCTCAAACCTCGAGGTTTGAGATGTTGGACGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)