EMAIL THIS PAGE TO A FRIEND

IFFO1

intermediate filament family orphan 1

78 Gene Product Result for
Synonyms: HOM-TES-103 IFFO
UniProtKB ID: Q0D2I5, Q24JT6, Q7L5J9, Q7Z5X4, Q9BQ46
Gene ID:
Human(25900) Summary: This gene is a member of the intermediate filament family. Intermediate filaments are proteins which are primordial components of the cytoskeleton and nuclear envelope. The proteins encoded by the members of this gene family are evolutionarily and structurally related but have limited sequence homology, with the exception of the central rod domain. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(320678) intermediate filament family orphan 1
Rat(362437) intermediate filament family orphan 1
chicken(418276) intermediate filament family orphan 1
dog(486725) intermediate filament family orphan 1
Horse(100146302) intermediate filament family orphan 1
cow(506821) intermediate filament family orphan 1
domestic cat(101092618) intermediate filament family orphan 1
sheep(101110140) intermediate filament family orphan 1
domestic guinea pig(100728016) intermediate filament family orphan 1
naked mole-rat(101705390) intermediate filament family orphan 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015438 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085941 MISSION® esiRNA esiRNA targeting mouse Iffo1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039670 Rosetta Predictions human pricing
NM_080730 Rosetta Predictions human pricing
NM_080731 Rosetta Predictions human pricing
NM_001108647 Rosetta Predictions rat pricing
NM_001039669 Rosetta Predictions mouse pricing
NM_178787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146256 predicted 2040
2 SASI_Hs01_00146257 predicted 1701
3 SASI_Hs01_00146258 predicted 1671
4 SASI_Hs01_00146259 predicted 1683
5 SASI_Hs01_00146260 predicted 2130
6 SASI_Hs01_00146261 predicted 2039
7 SASI_Hs01_00146262 predicted 1608
8 SASI_Hs02_00308631 predicted 2098
9 SASI_Hs02_00308632 predicted 1266
10 SASI_Hs01_00146264 predicted 739
11 SASI_Hs01_00146263 predicted 231
12 SASI_Hs01_00146265 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136814 predicted 2019
2 SASI_Hs01_00136815 predicted 1686
3 SASI_Hs01_00136816 predicted 1664
4 SASI_Hs01_00136817 predicted 1674
5 SASI_Hs01_00136818 predicted 2113
6 SASI_Hs01_00136819 predicted 2021
7 SASI_Hs01_00136820 predicted 1601
8 SASI_Hs02_00362508 predicted 2090
9 SASI_Hs02_00362509 predicted 1249
10 SASI_Hs01_00136822 predicted 733
11 SASI_Hs01_00136821 predicted 232
12 SASI_Hs01_00136823 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177329 predicted 1201
2 SASI_Hs01_00177330 predicted 868
3 SASI_Hs01_00177331 predicted 841
4 SASI_Hs01_00177332 predicted 852
5 SASI_Hs01_00177333 predicted 1297
6 SASI_Hs01_00177334 predicted 1207
7 SASI_Hs01_00177335 predicted 775
8 SASI_Hs02_00362510 predicted 1264
9 SASI_Hs01_00177336 predicted 431
10 SASI_Hs02_00362511 predicted 1201
11 SASI_Hs01_00177337 predicted 618
12 SASI_Hs01_00177338 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240689 predicted 1926
2 SASI_Rn02_00240690 predicted 721
3 SASI_Rn02_00240691 predicted 226
4 SASI_Rn02_00240692 predicted 915
5 SASI_Rn02_00240693 predicted 1859
6 SASI_Rn02_00240694 predicted 816
7 SASI_Rn02_00240695 predicted 1013
8 SASI_Rn02_00240696 predicted 1449
9 SASI_Rn02_00240697 predicted 382
10 SASI_Rn02_00240698 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290194 predicted 2042
2 SASI_Mm02_00290195 predicted 1888
3 SASI_Mm02_00290196 predicted 1286
4 SASI_Mm02_00290197 predicted 808
5 SASI_Mm02_00290198 predicted 210
6 SASI_Mm02_00290199 predicted 1840
7 SASI_Mm02_00290200 predicted 203
8 SASI_Mm02_00290201 predicted 1949
9 SASI_Mm02_00290202 predicted 2072
10 SASI_Mm02_00290203 predicted 2057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189774 predicted 2044
2 SASI_Mm01_00189775 predicted 1891
3 SASI_Mm01_00189776 predicted 1292
4 SASI_Mm01_00189777 predicted 817
5 SASI_Mm01_00189778 predicted 223
6 SASI_Mm02_00349383 predicted 1842
7 SASI_Mm01_00189779 predicted 217
8 SASI_Mm01_00189780 predicted 1950
9 SASI_Mm01_00189781 predicted 2071
10 SASI_Mm01_00189782 predicted 2053
11 SASI_Mm01_00189773 predicted 1894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178787
VALIDATED
IFFO1 MISSION shRNA Bacterial Glycerol Stock
intermediate filament family orphan 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-985s1c1
Sequence:CCGGCCATGAAAGTCGACATGGACACTCGAGTGTCCATGTCGACTTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1678s1c1
Sequence:CCGGCATCTGATAGCTCCATGAGATCTCGAGATCTCATGGAGCTATCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178787.2-1448s1c1
Sequence:CCGGCATTGACCAGATAGAGCTGGACTCGAGTCCAGCTCTATCTGGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-815s1c1
Sequence:CCGGGATACAGCTACAAGAGCGAGTCTCGAGACTCGCTCTTGTAGCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1055s1c1
Sequence:CCGGGCGCAACTGTGAGGATATGATCTCGAGATCATATCCTCACAGTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1665s1c1
Sequence:CCGGGATCGAGACGTCTCATCTGATCTCGAGATCAGATGAGACGTCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1054s21c1
Sequence:CCGGGCGCAACTGTGAGGATATGATCTCGAGATCATATCCTCACAGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178787.5-1240s21c1
Sequence:CCGGCCAGCTGAGGGAGTATGATTTCTCGAGAAATCATACTCCCTCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178787.5-1306s1c1
Sequence:CCGGCTTGCTACTTTGGGAGGATTTCTCGAGAAATCCTCCCAAAGTAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1377s21c1
Sequence:CCGGGCCTGGAGAAGGTGATCAAAGCTCGAGCTTTGATCACCTTCTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1674s21c1
Sequence:CCGGCATCTGATAGCTCCATGAGATCTCGAGATCTCATGGAGCTATCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178787
VALIDATED
IFFO1 MISSION shRNA shRNA Plasmid DNA
intermediate filament family orphan 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-985s1c1
Sequence:CCGGCCATGAAAGTCGACATGGACACTCGAGTGTCCATGTCGACTTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1678s1c1
Sequence:CCGGCATCTGATAGCTCCATGAGATCTCGAGATCTCATGGAGCTATCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178787.2-1448s1c1
Sequence:CCGGCATTGACCAGATAGAGCTGGACTCGAGTCCAGCTCTATCTGGTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-815s1c1
Sequence:CCGGGATACAGCTACAAGAGCGAGTCTCGAGACTCGCTCTTGTAGCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1055s1c1
Sequence:CCGGGCGCAACTGTGAGGATATGATCTCGAGATCATATCCTCACAGTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1665s1c1
Sequence:CCGGGATCGAGACGTCTCATCTGATCTCGAGATCAGATGAGACGTCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1054s21c1
Sequence:CCGGGCGCAACTGTGAGGATATGATCTCGAGATCATATCCTCACAGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178787.5-1240s21c1
Sequence:CCGGCCAGCTGAGGGAGTATGATTTCTCGAGAAATCATACTCCCTCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178787.5-1306s1c1
Sequence:CCGGCTTGCTACTTTGGGAGGATTTCTCGAGAAATCCTCCCAAAGTAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1377s21c1
Sequence:CCGGGCCTGGAGAAGGTGATCAAAGCTCGAGCTTTGATCACCTTCTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1674s21c1
Sequence:CCGGCATCTGATAGCTCCATGAGATCTCGAGATCTCATGGAGCTATCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178787
VALIDATED
IFFO1 MISSION shRNA Lentiviral Transduction Particles
intermediate filament family orphan 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-985s1c1
Sequence:CCGGCCATGAAAGTCGACATGGACACTCGAGTGTCCATGTCGACTTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1678s1c1
Sequence:CCGGCATCTGATAGCTCCATGAGATCTCGAGATCTCATGGAGCTATCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178787.2-1448s1c1
Sequence:CCGGCATTGACCAGATAGAGCTGGACTCGAGTCCAGCTCTATCTGGTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-815s1c1
Sequence:CCGGGATACAGCTACAAGAGCGAGTCTCGAGACTCGCTCTTGTAGCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1055s1c1
Sequence:CCGGGCGCAACTGTGAGGATATGATCTCGAGATCATATCCTCACAGTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178787.2-1665s1c1
Sequence:CCGGGATCGAGACGTCTCATCTGATCTCGAGATCAGATGAGACGTCTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1054s21c1
Sequence:CCGGGCGCAACTGTGAGGATATGATCTCGAGATCATATCCTCACAGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178787.5-1240s21c1
Sequence:CCGGCCAGCTGAGGGAGTATGATTTCTCGAGAAATCATACTCCCTCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178787.5-1306s1c1
Sequence:CCGGCTTGCTACTTTGGGAGGATTTCTCGAGAAATCCTCCCAAAGTAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1377s21c1
Sequence:CCGGGCCTGGAGAAGGTGATCAAAGCTCGAGCTTTGATCACCTTCTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178787.5-1674s21c1
Sequence:CCGGCATCTGATAGCTCCATGAGATCTCGAGATCTCATGGAGCTATCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015438
IFFO1 MISSION shRNA Bacterial Glycerol Stock
intermediate filament family orphan 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015438.1-2431s1c1
Sequence:CCGGCCGTGCTTTAAAGAGGCCTTACTCGAGTAAGGCCTCTTTAAAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-247s1c1
Sequence:CCGGCTCCAACATCAACGTGCTCAACTCGAGTTGAGCACGTTGATGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-793s1c1
Sequence:CCGGCGAGTACAAGCGGAGATGCTTCTCGAGAAGCATCTCCGCTTGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-682s1c1
Sequence:CCGGGCCTGGCTTGTCGTGGGTGCACTCGAGTGCACCCACGACAAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-739s1c1
Sequence:CCGGGCCCGAGATCCGCGCTCTCTACTCGAGTAGAGAGCGCGGATCTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015438
IFFO1 MISSION shRNA shRNA Plasmid DNA
intermediate filament family orphan 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015438.1-2431s1c1
Sequence:CCGGCCGTGCTTTAAAGAGGCCTTACTCGAGTAAGGCCTCTTTAAAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-247s1c1
Sequence:CCGGCTCCAACATCAACGTGCTCAACTCGAGTTGAGCACGTTGATGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-793s1c1
Sequence:CCGGCGAGTACAAGCGGAGATGCTTCTCGAGAAGCATCTCCGCTTGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-682s1c1
Sequence:CCGGGCCTGGCTTGTCGTGGGTGCACTCGAGTGCACCCACGACAAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-739s1c1
Sequence:CCGGGCCCGAGATCCGCGCTCTCTACTCGAGTAGAGAGCGCGGATCTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015438
IFFO1 MISSION shRNA Lentiviral Transduction Particles
intermediate filament family orphan 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015438.1-2431s1c1
Sequence:CCGGCCGTGCTTTAAAGAGGCCTTACTCGAGTAAGGCCTCTTTAAAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-247s1c1
Sequence:CCGGCTCCAACATCAACGTGCTCAACTCGAGTTGAGCACGTTGATGTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-793s1c1
Sequence:CCGGCGAGTACAAGCGGAGATGCTTCTCGAGAAGCATCTCCGCTTGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-682s1c1
Sequence:CCGGGCCTGGCTTGTCGTGGGTGCACTCGAGTGCACCCACGACAAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015438.1-739s1c1
Sequence:CCGGGCCCGAGATCCGCGCTCTCTACTCGAGTAGAGAGCGCGGATCTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)