EMAIL THIS PAGE TO A FRIEND

IFFO2

intermediate filament family orphan 2

80 Gene Product Result for
UniProtKB ID: Q5TF58, Q9H7K0
Gene ID:
Mouse(212632) intermediate filament family orphan 2
Rat(641315) intermediate filament family orphan 2
chicken(419468) intermediate filament family orphan 2
dog(100688342) intermediate filament family orphan 2
cow(788579) intermediate filament family orphan 2
domestic cat(101090032) intermediate filament family orphan 2
domestic guinea pig(100725579) intermediate filament family orphan 2
naked mole-rat(101698361) intermediate filament family orphan 2
sheep(101105641) intermediate filament family orphan 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714732 Rosetta Predictions human pricing
XM_001721924 Rosetta Predictions human pricing
XM_001722365 Rosetta Predictions human pricing
XM_928886 Rosetta Predictions human pricing
NM_001134703 Rosetta Predictions rat pricing
NM_183148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399053 predicted 1608
2 SASI_Hs02_00399054 predicted 2317
3 SASI_Hs02_00399055 predicted 1819
4 SASI_Hs02_00399056 predicted 2297
5 SASI_Hs02_00399057 predicted 1799
6 SASI_Hs02_00399058 predicted 1220
7 SASI_Hs02_00399059 predicted 2346
8 SASI_Hs02_00399060 predicted 1426
9 SASI_Hs02_00399061 predicted 2401
10 SASI_Hs02_00399062 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00445939 predicted 1074
2 SASI_Hs02_00445940 predicted 1777
3 SASI_Hs02_00445941 predicted 1277
4 SASI_Hs02_00445942 predicted 1754
5 SASI_Hs02_00445943 predicted 1256
6 SASI_Hs02_00445944 predicted 684
7 SASI_Hs02_00445945 predicted 1809
8 SASI_Hs02_00445946 predicted 881
9 SASI_Hs02_00445947 predicted 1854
10 SASI_Hs02_00445948 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00448724 predicted 1068
2 SASI_Hs02_00448725 predicted 1773
3 SASI_Hs02_00448726 predicted 1275
4 SASI_Hs02_00448727 predicted 1755
5 SASI_Hs02_00448728 predicted 1258
6 SASI_Hs02_00448729 predicted 681
7 SASI_Hs02_00448730 predicted 1811
8 SASI_Hs02_00448731 predicted 883
9 SASI_Hs02_00448732 predicted 1863
10 SASI_Hs02_00448733 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274631 predicted 1274
2 SASI_Hs01_00274632 predicted 1969
3 SASI_Hs01_00274633 predicted 1473
4 SASI_Hs01_00274634 predicted 1960
5 SASI_Hs01_00274635 predicted 1451
6 SASI_Hs01_00274636 predicted 881
7 SASI_Hs01_00274637 predicted 2012
8 SASI_Hs01_00274638 predicted 1082
9 SASI_Hs01_00274639 predicted 2064
10 SASI_Hs01_00274640 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258044 predicted 534
2 SASI_Rn02_00258045 predicted 708
3 SASI_Rn02_00258046 predicted 728
4 SASI_Rn02_00258047 predicted 448
5 SASI_Rn02_00258048 predicted 416
6 SASI_Rn02_00258049 predicted 836
7 SASI_Rn02_00258050 predicted 510
8 SASI_Rn02_00258051 predicted 581
9 SASI_Rn02_00258052 predicted 698
10 SASI_Rn02_00258053 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114553 predicted 1606
2 SASI_Mm02_00350190 predicted 855
3 SASI_Mm01_00114551 predicted 866
4 SASI_Mm02_00350191 predicted 869
5 SASI_Mm02_00350192 predicted 1053
6 SASI_Mm02_00350193 predicted 682
7 SASI_Mm01_00114558 predicted 1500
8 SASI_Mm02_00350194 predicted 586
9 SASI_Mm01_00114560 predicted 1598
10 SASI_Mm02_00350195 predicted 1073
11 SASI_Mm01_00114552 predicted 1173
12 SASI_Mm01_00114554 predicted 835
13 SASI_Mm01_00114555 predicted 982
14 SASI_Mm01_00114556 predicted 1072
15 SASI_Mm01_00114557 predicted 1142
16 SASI_Mm01_00114559 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136265
IFFO2 MISSION shRNA Bacterial Glycerol Stock
intermediate filament family orphan 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1286s21c1
Sequence:CCGGAGGAGTACCAGGAAACGATAGCTCGAGCTATCGTTTCCTGGTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136265.1-3227s21c1
Sequence:CCGGTGACTATGTGTGATGTAATTTCTCGAGAAATTACATCACACATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1245s21c1
Sequence:CCGGCTTGATCCATGAGACCGAATCCTCGAGGATTCGGTCTCATGGATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1103s21c1
Sequence:CCGGTGCGGGAGACCTTTGACTTTGCTCGAGCAAAGTCAAAGGTCTCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136265
IFFO2 MISSION shRNA shRNA Plasmid DNA
intermediate filament family orphan 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1286s21c1
Sequence:CCGGAGGAGTACCAGGAAACGATAGCTCGAGCTATCGTTTCCTGGTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136265.1-3227s21c1
Sequence:CCGGTGACTATGTGTGATGTAATTTCTCGAGAAATTACATCACACATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1245s21c1
Sequence:CCGGCTTGATCCATGAGACCGAATCCTCGAGGATTCGGTCTCATGGATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1103s21c1
Sequence:CCGGTGCGGGAGACCTTTGACTTTGCTCGAGCAAAGTCAAAGGTCTCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136265
IFFO2 MISSION shRNA Lentiviral Transduction Particles
intermediate filament family orphan 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1286s21c1
Sequence:CCGGAGGAGTACCAGGAAACGATAGCTCGAGCTATCGTTTCCTGGTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136265.1-3227s21c1
Sequence:CCGGTGACTATGTGTGATGTAATTTCTCGAGAAATTACATCACACATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1245s21c1
Sequence:CCGGCTTGATCCATGAGACCGAATCCTCGAGGATTCGGTCTCATGGATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136265.1-1103s21c1
Sequence:CCGGTGCGGGAGACCTTTGACTTTGCTCGAGCAAAGTCAAAGGTCTCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183148
VALIDATED
IFFO2 MISSION shRNA Bacterial Glycerol Stock
intermediate filament family orphan 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183148.1-247s1c1
Sequence:CCGGCCGAATCGATATCACGGCTAACTCGAGTTAGCCGTGATATCGATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-1282s21c1
Sequence:CCGGCTCAGGAAGTACAGACGAAATCTCGAGATTTCGTCTGTACTTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-3148s21c1
Sequence:CCGGTCATACACTTCTGGTTATTATCTCGAGATAATAACCAGAAGTGTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-686s21c1
Sequence:CCGGCGAATCGATATCACGGCTAAGCTCGAGCTTAGCCGTGATATCGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-1146s21c1
Sequence:CCGGACCGACACCTTCATGAGTATACTCGAGTATACTCATGAAGGTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183148
VALIDATED
IFFO2 MISSION shRNA shRNA Plasmid DNA
intermediate filament family orphan 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183148.1-247s1c1
Sequence:CCGGCCGAATCGATATCACGGCTAACTCGAGTTAGCCGTGATATCGATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-1282s21c1
Sequence:CCGGCTCAGGAAGTACAGACGAAATCTCGAGATTTCGTCTGTACTTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-3148s21c1
Sequence:CCGGTCATACACTTCTGGTTATTATCTCGAGATAATAACCAGAAGTGTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-686s21c1
Sequence:CCGGCGAATCGATATCACGGCTAAGCTCGAGCTTAGCCGTGATATCGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-1146s21c1
Sequence:CCGGACCGACACCTTCATGAGTATACTCGAGTATACTCATGAAGGTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183148
VALIDATED
IFFO2 MISSION shRNA Lentiviral Transduction Particles
intermediate filament family orphan 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183148.1-247s1c1
Sequence:CCGGCCGAATCGATATCACGGCTAACTCGAGTTAGCCGTGATATCGATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-1282s21c1
Sequence:CCGGCTCAGGAAGTACAGACGAAATCTCGAGATTTCGTCTGTACTTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-3148s21c1
Sequence:CCGGTCATACACTTCTGGTTATTATCTCGAGATAATAACCAGAAGTGTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-686s21c1
Sequence:CCGGCGAATCGATATCACGGCTAAGCTCGAGCTTAGCCGTGATATCGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183148.2-1146s21c1
Sequence:CCGGACCGACACCTTCATGAGTATACTCGAGTATACTCATGAAGGTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)