EMAIL THIS PAGE TO A FRIEND

IFI27

interferon, alpha-inducible protein 27

97 Gene Product Result for
Synonyms: FAM14D ISG12 ISG12A P27
UniProtKB ID: P40305, Q53YA6, Q6IEC1, Q96BK3
Gene ID:
Mouse(52668) interferon, alpha-inducible protein 27
Rat(170512) interferon, alpha-inducible protein 27
cow(507138) putative ISG12(a) protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005532 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005532 Rosetta Predictions human pricing
NM_130743 Rosetta Predictions rat pricing
NM_203410 Rosetta Predictions rat pricing
NM_026790 Rosetta Predictions mouse pricing
NM_194066 Rosetta Predictions mouse pricing
NM_194067 Rosetta Predictions mouse pricing
NM_194068 Rosetta Predictions mouse pricing
NM_194069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191026 predicted 387
2 SASI_Hs01_00191030 predicted 241
3 SASI_Hs01_00191032 predicted 381
4 SASI_Hs01_00191033 predicted 237
5 SASI_Hs02_00339764 predicted 428
6 SASI_Hs02_00339765 predicted 406
7 SASI_Hs01_00191027 predicted 403
8 SASI_Hs01_00191028 predicted 399
9 SASI_Hs01_00191029 predicted 404
10 SASI_Hs02_00339766 predicted 205
11 SASI_Hs01_00191031 predicted 399
12 SASI_Hs01_00191034 predicted 418
13 SASI_Hs01_00191035 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117588 predicted 222
2 SASI_Rn01_00117589 predicted 300
3 SASI_Rn01_00117590 predicted 284
4 SASI_Rn01_00117591 predicted 294
5 SASI_Rn01_00117592 predicted 306
6 SASI_Rn01_00117593 predicted 312
7 SASI_Rn01_00117594 predicted 301
8 SASI_Rn01_00117595 predicted 312
9 SASI_Rn01_00117596 predicted 361
10 SASI_Rn01_00117597 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036573 predicted 433
2 SASI_Rn01_00036574 predicted 525
3 SASI_Rn01_00036575 predicted 255
4 SASI_Rn01_00036576 predicted 570
5 SASI_Rn01_00036578 predicted 447
6 SASI_Rn01_00036579 predicted 195
7 SASI_Rn01_00036580 predicted 256
8 SASI_Rn01_00036581 predicted 352
9 SASI_Rn01_00036582 predicted 556
10 SASI_Rn02_00270369 predicted 383
11 SASI_Rn01_00036577 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191423 predicted 204
2 SASI_Mm01_00191424 predicted 308
3 SASI_Mm01_00191425 predicted 313
4 SASI_Mm01_00191426 predicted 307
5 SASI_Mm01_00191427 predicted 312
6 SASI_Mm01_00191428 predicted 256
7 SASI_Mm01_00191429 predicted 225
8 SASI_Mm01_00191430 predicted 221
9 SASI_Mm01_00191431 predicted 266
10 SASI_Mm01_00191432 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039921 predicted 206
2 SASI_Mm01_00039922 predicted 304
3 SASI_Mm01_00039923 predicted 311
4 SASI_Mm01_00039924 predicted 309
5 SASI_Mm01_00039925 predicted 310
6 SASI_Mm01_00039926 predicted 251
7 SASI_Mm01_00039927 predicted 227
8 SASI_Mm01_00039928 predicted 226
9 SASI_Mm01_00039929 predicted 264
10 SASI_Mm01_00039930 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350588 predicted 481
2 SASI_Mm01_00170516 predicted 519
3 SASI_Mm01_00170517 predicted 532
4 SASI_Mm01_00170519 predicted 253
5 SASI_Mm01_00170520 predicted 340
6 SASI_Mm01_00170521 predicted 609
7 SASI_Mm01_00170522 predicted 294
8 SASI_Mm01_00170523 predicted 529
9 SASI_Mm01_00170524 predicted 346
10 SASI_Mm01_00170525 predicted 533
11 SASI_Mm01_00170518 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090469 predicted 476
2 SASI_Mm01_00090470 predicted 484
3 SASI_Mm01_00090471 predicted 500
4 SASI_Mm01_00090472 predicted 473
5 SASI_Mm01_00090473 predicted 251
6 SASI_Mm01_00090474 predicted 346
7 SASI_Mm01_00090475 predicted 582
8 SASI_Mm01_00090476 predicted 264
9 SASI_Mm01_00090477 predicted 290
10 SASI_Mm01_00090478 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066167 predicted 360
2 SASI_Mm01_00066168 predicted 364
3 SASI_Mm01_00066169 predicted 381
4 SASI_Mm01_00066170 predicted 250
5 SASI_Mm01_00066171 predicted 454
6 SASI_Mm01_00066172 predicted 457
7 SASI_Mm01_00066173 predicted 383
8 SASI_Mm01_00066174 predicted 270
9 SASI_Mm01_00066175 predicted 384
10 SASI_Mm01_00066176 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194069
IFI27 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha-inducible protein 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-373s1c1
Sequence:CCGGGCTAAGATGATGTCCTTGTCACTCGAGTGACAAGGACATCATCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-360s1c1
Sequence:CCGGCTCCTCTCTAGCAGCTAAGATCTCGAGATCTTAGCTGCTAGAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-534s1c1
Sequence:CCGGCTGTGAGAGTTTCTACCCTTTCTCGAGAAAGGGTAGAAACTCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-222s1c1
Sequence:CCGGGATGACATCTTCAGCAGCCATCTCGAGATGGCTGCTGAAGATGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-362s1c1
Sequence:CCGGCCTCTCTAGCAGCTAAGATGACTCGAGTCATCTTAGCTGCTAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194069
IFI27 MISSION shRNA shRNA Plasmid DNA
interferon, alpha-inducible protein 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-373s1c1
Sequence:CCGGGCTAAGATGATGTCCTTGTCACTCGAGTGACAAGGACATCATCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-360s1c1
Sequence:CCGGCTCCTCTCTAGCAGCTAAGATCTCGAGATCTTAGCTGCTAGAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-534s1c1
Sequence:CCGGCTGTGAGAGTTTCTACCCTTTCTCGAGAAAGGGTAGAAACTCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-222s1c1
Sequence:CCGGGATGACATCTTCAGCAGCCATCTCGAGATGGCTGCTGAAGATGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-362s1c1
Sequence:CCGGCCTCTCTAGCAGCTAAGATGACTCGAGTCATCTTAGCTGCTAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194069
IFI27 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha-inducible protein 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-373s1c1
Sequence:CCGGGCTAAGATGATGTCCTTGTCACTCGAGTGACAAGGACATCATCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-360s1c1
Sequence:CCGGCTCCTCTCTAGCAGCTAAGATCTCGAGATCTTAGCTGCTAGAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-534s1c1
Sequence:CCGGCTGTGAGAGTTTCTACCCTTTCTCGAGAAAGGGTAGAAACTCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-222s1c1
Sequence:CCGGGATGACATCTTCAGCAGCCATCTCGAGATGGCTGCTGAAGATGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194069.1-362s1c1
Sequence:CCGGCCTCTCTAGCAGCTAAGATGACTCGAGTCATCTTAGCTGCTAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005532
IFI27 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha-inducible protein 27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-223s1c1
Sequence:CCGGGCTACAGTTGTGATTGGAGGACTCGAGTCCTCCAATCACAACTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-458s1c1
Sequence:CCGGCGGCTGTCATTGCGAGGTTCTCTCGAGAGAACCTCGCAATGACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-411s1c1
Sequence:CCGGCTCCGGATTGACCAAGTTCATCTCGAGATGAACTTGGTCAATCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005532.3-498s1c1
Sequence:CCGGCCCTGCAGAGAAGAGAACCATCTCGAGATGGTTCTCTTCTCTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-185s1c1
Sequence:CCGGCCTCTGGCTCTGCCGTAGTTTCTCGAGAAACTACGGCAGAGCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-467s21c1
Sequence:CCGGTTGCGAGGTTCTACTAGCTCCCTCGAGGGAGCTAGTAGAACCTCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-388s21c1
Sequence:CCGGCAGTCACTGGGAGCAACTGGACTCGAGTCCAGTTGCTCCCAGTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-437s21c1
Sequence:CCGGGCTCCATTGGGTCTGCCATTGCTCGAGCAATGGCAGACCCAATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-213s21c1
Sequence:CCGGGGCCAGGATTGCTACAGTTGTCTCGAGACAACTGTAGCAATCCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005532
IFI27 MISSION shRNA shRNA Plasmid DNA
interferon, alpha-inducible protein 27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-223s1c1
Sequence:CCGGGCTACAGTTGTGATTGGAGGACTCGAGTCCTCCAATCACAACTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-458s1c1
Sequence:CCGGCGGCTGTCATTGCGAGGTTCTCTCGAGAGAACCTCGCAATGACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-411s1c1
Sequence:CCGGCTCCGGATTGACCAAGTTCATCTCGAGATGAACTTGGTCAATCCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005532.3-498s1c1
Sequence:CCGGCCCTGCAGAGAAGAGAACCATCTCGAGATGGTTCTCTTCTCTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-185s1c1
Sequence:CCGGCCTCTGGCTCTGCCGTAGTTTCTCGAGAAACTACGGCAGAGCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-467s21c1
Sequence:CCGGTTGCGAGGTTCTACTAGCTCCCTCGAGGGAGCTAGTAGAACCTCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-388s21c1
Sequence:CCGGCAGTCACTGGGAGCAACTGGACTCGAGTCCAGTTGCTCCCAGTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-437s21c1
Sequence:CCGGGCTCCATTGGGTCTGCCATTGCTCGAGCAATGGCAGACCCAATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-213s21c1
Sequence:CCGGGGCCAGGATTGCTACAGTTGTCTCGAGACAACTGTAGCAATCCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005532
IFI27 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha-inducible protein 27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-223s1c1
Sequence:CCGGGCTACAGTTGTGATTGGAGGACTCGAGTCCTCCAATCACAACTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-458s1c1
Sequence:CCGGCGGCTGTCATTGCGAGGTTCTCTCGAGAGAACCTCGCAATGACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-411s1c1
Sequence:CCGGCTCCGGATTGACCAAGTTCATCTCGAGATGAACTTGGTCAATCCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005532.3-498s1c1
Sequence:CCGGCCCTGCAGAGAAGAGAACCATCTCGAGATGGTTCTCTTCTCTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005532.3-185s1c1
Sequence:CCGGCCTCTGGCTCTGCCGTAGTTTCTCGAGAAACTACGGCAGAGCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-467s21c1
Sequence:CCGGTTGCGAGGTTCTACTAGCTCCCTCGAGGGAGCTAGTAGAACCTCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-388s21c1
Sequence:CCGGCAGTCACTGGGAGCAACTGGACTCGAGTCCAGTTGCTCCCAGTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-437s21c1
Sequence:CCGGGCTCCATTGGGTCTGCCATTGCTCGAGCAATGGCAGACCCAATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005532.3-213s21c1
Sequence:CCGGGGCCAGGATTGCTACAGTTGTCTCGAGACAACTGTAGCAATCCTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)