EMAIL THIS PAGE TO A FRIEND

IFI27L1

interferon, alpha-inducible protein 27-like 1

26 Gene Product Result for
Synonyms: FAM14B ISG12C
Species: Human IFI27L1(122509)
UniProtKB ID: Q96BM0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012551 MISSION® esiRNA esiRNA targeting human IFI27L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145249 Rosetta Predictions human pricing
NM_206949 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191056 predicted 401
2 SASI_Hs01_00191057 predicted 438
3 SASI_Hs01_00191058 predicted 317
4 SASI_Hs01_00191059 predicted 390
5 SASI_Hs01_00191060 predicted 449
6 SASI_Hs01_00191061 predicted 446
7 SASI_Hs01_00191062 predicted 441
8 SASI_Hs01_00191063 predicted 414
9 SASI_Hs01_00191064 predicted 407
10 SASI_Hs02_00365092 predicted 219
11 SASI_Hs01_00191065 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144929 predicted 419
2 SASI_Hs01_00144930 predicted 462
3 SASI_Hs01_00144931 predicted 338
4 SASI_Hs01_00144932 predicted 412
5 SASI_Hs01_00144933 predicted 464
6 SASI_Hs01_00144934 predicted 469
7 SASI_Hs01_00144935 predicted 458
8 SASI_Hs01_00144936 predicted 427
9 SASI_Hs01_00144937 predicted 428
10 SASI_Hs02_00373655 predicted 232
11 SASI_Hs01_00144938 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145249
IFI27L1 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha-inducible protein 27-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-367s21c1
Sequence:CCGGCAGTAGGAATCGCCGCATCCTCTCGAGAGGATGCGGCGATTCCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-352s1c1
Sequence:CCGGCCATAGCAGCCAAGATGATGTCTCGAGACATCATCTTGGCTGCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-455s1c1
Sequence:CCGGCTCTGTGACATCTAAAGTTATCTCGAGATAACTTTAGATGTCACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-357s21c1
Sequence:CCGGGGCTTCACCTCAGTAGGAATCCTCGAGGATTCCTACTGAGGTGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-516s21c1
Sequence:CCGGGGCTTTGCTGGGACAGCTCTTCTCGAGAAGAGCTGTCCCAGCAAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-365s1c1
Sequence:CCGGGATGATGTCTACAGCAGCCATCTCGAGATGGCTGCTGTAGACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-357s1c1
Sequence:CCGGGCAGCCAAGATGATGTCTACACTCGAGTGTAGACATCATCTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-456s21c1
Sequence:CCGGGTGGCTATTCTGCAGTCAGTGCTCGAGCACTGACTGCAGAATAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145249
IFI27L1 MISSION shRNA shRNA Plasmid DNA
interferon, alpha-inducible protein 27-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-367s21c1
Sequence:CCGGCAGTAGGAATCGCCGCATCCTCTCGAGAGGATGCGGCGATTCCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-352s1c1
Sequence:CCGGCCATAGCAGCCAAGATGATGTCTCGAGACATCATCTTGGCTGCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-455s1c1
Sequence:CCGGCTCTGTGACATCTAAAGTTATCTCGAGATAACTTTAGATGTCACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-357s21c1
Sequence:CCGGGGCTTCACCTCAGTAGGAATCCTCGAGGATTCCTACTGAGGTGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-516s21c1
Sequence:CCGGGGCTTTGCTGGGACAGCTCTTCTCGAGAAGAGCTGTCCCAGCAAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-365s1c1
Sequence:CCGGGATGATGTCTACAGCAGCCATCTCGAGATGGCTGCTGTAGACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-357s1c1
Sequence:CCGGGCAGCCAAGATGATGTCTACACTCGAGTGTAGACATCATCTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-456s21c1
Sequence:CCGGGTGGCTATTCTGCAGTCAGTGCTCGAGCACTGACTGCAGAATAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145249
IFI27L1 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha-inducible protein 27-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-367s21c1
Sequence:CCGGCAGTAGGAATCGCCGCATCCTCTCGAGAGGATGCGGCGATTCCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-352s1c1
Sequence:CCGGCCATAGCAGCCAAGATGATGTCTCGAGACATCATCTTGGCTGCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-455s1c1
Sequence:CCGGCTCTGTGACATCTAAAGTTATCTCGAGATAACTTTAGATGTCACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-357s21c1
Sequence:CCGGGGCTTCACCTCAGTAGGAATCCTCGAGGATTCCTACTGAGGTGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-516s21c1
Sequence:CCGGGGCTTTGCTGGGACAGCTCTTCTCGAGAAGAGCTGTCCCAGCAAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-365s1c1
Sequence:CCGGGATGATGTCTACAGCAGCCATCTCGAGATGGCTGCTGTAGACATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145249.1-357s1c1
Sequence:CCGGGCAGCCAAGATGATGTCTACACTCGAGTGTAGACATCATCTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145249.2-456s21c1
Sequence:CCGGGTGGCTATTCTGCAGTCAGTGCTCGAGCACTGACTGCAGAATAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)