EMAIL THIS PAGE TO A FRIEND

IFI27L2

interferon, alpha-inducible protein 27-like 2

17 Gene Product Result for
Synonyms: FAM14A ISG12B TLH29
UniProtKB ID: Q9H2X8, Q8TBD7, Q9NYL0
Gene ID:
chicken(403121) interferon, alpha-inducible protein 27-like 2
cow(535465) interferon, alpha-inducible protein 27-like 2
domestic guinea pig(100714076) interferon, alpha-inducible protein 27-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032036 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042051 MISSION® esiRNA esiRNA human IFI27L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032036 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227689 predicted 227
2 SASI_Hs01_00227690 predicted 262
3 SASI_Hs01_00227691 predicted 253
4 SASI_Hs01_00227692 predicted 427
5 SASI_Hs01_00227693 predicted 364
6 SASI_Hs01_00227694 predicted 344
7 SASI_Hs01_00227695 predicted 426
8 SASI_Hs01_00227696 predicted 337
9 SASI_Hs01_00227697 predicted 259
10 SASI_Hs01_00227698 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032036
VALIDATED
IFI27L2 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha-inducible protein 27-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-294s21c1
Sequence:CCGGGCCTCTGTTGGGTCAGTGTTGCTCGAGCAACACTGACCCAACAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032036.1-137s1c1
Sequence:CCGGGCAGCCAAGATGATGTCCGCACTCGAGTGCGGACATCATCTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-164s21c1
Sequence:CCGGCTCCATAGCAGCCAAGATGATCTCGAGATCATCTTGGCTGCTATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-181s21c1
Sequence:CCGGTGATGTCCGCAGCAGCCATTGCTCGAGCAATGGCTGCTGCGGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032036.1-238s1c1
Sequence:CCGGCACATCATCCAACATCCTCCTCTCGAGAGGAGGATGTTGGATGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-268s21c1
Sequence:CCGGTCTCCACATCATCCAACATCCCTCGAGGGATGTTGGATGATGTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-283s21c1
Sequence:CCGGACATCCTCCTGGCCTCTGTTGCTCGAGCAACAGAGGCCAGGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032036
VALIDATED
IFI27L2 MISSION shRNA shRNA Plasmid DNA
interferon, alpha-inducible protein 27-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-294s21c1
Sequence:CCGGGCCTCTGTTGGGTCAGTGTTGCTCGAGCAACACTGACCCAACAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032036.1-137s1c1
Sequence:CCGGGCAGCCAAGATGATGTCCGCACTCGAGTGCGGACATCATCTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-164s21c1
Sequence:CCGGCTCCATAGCAGCCAAGATGATCTCGAGATCATCTTGGCTGCTATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-181s21c1
Sequence:CCGGTGATGTCCGCAGCAGCCATTGCTCGAGCAATGGCTGCTGCGGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032036.1-238s1c1
Sequence:CCGGCACATCATCCAACATCCTCCTCTCGAGAGGAGGATGTTGGATGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-268s21c1
Sequence:CCGGTCTCCACATCATCCAACATCCCTCGAGGGATGTTGGATGATGTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-283s21c1
Sequence:CCGGACATCCTCCTGGCCTCTGTTGCTCGAGCAACAGAGGCCAGGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032036
VALIDATED
IFI27L2 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha-inducible protein 27-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-294s21c1
Sequence:CCGGGCCTCTGTTGGGTCAGTGTTGCTCGAGCAACACTGACCCAACAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032036.1-137s1c1
Sequence:CCGGGCAGCCAAGATGATGTCCGCACTCGAGTGCGGACATCATCTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-164s21c1
Sequence:CCGGCTCCATAGCAGCCAAGATGATCTCGAGATCATCTTGGCTGCTATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-181s21c1
Sequence:CCGGTGATGTCCGCAGCAGCCATTGCTCGAGCAATGGCTGCTGCGGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032036.1-238s1c1
Sequence:CCGGCACATCATCCAACATCCTCCTCTCGAGAGGAGGATGTTGGATGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-268s21c1
Sequence:CCGGTCTCCACATCATCCAACATCCCTCGAGGGATGTTGGATGATGTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032036.2-283s21c1
Sequence:CCGGACATCCTCCTGGCCTCTGTTGCTCGAGCAACAGAGGCCAGGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)