EMAIL THIS PAGE TO A FRIEND

IFI44

interferon-induced protein 44

65 Gene Product Result for
Synonyms: MTAP44 TLDC5 p44
UniProtKB ID: Q8TCB0, D3DQ80, Q14496
Gene ID:
Mouse(99899) interferon-induced protein 44
Rat(310969) interferon-induced protein 44
domestic guinea pig(101787731) interferon-induced protein 44
naked mole-rat(101697690) interferon-induced protein 44
sheep(101110473) interferon-induced protein 44
cow(508348) interferon-induced protein 44
domestic cat(101090452) interferon-induced protein 44
dog(490198) interferon-induced protein 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006417 Rosetta Predictions human pricing
NM_001107729 Rosetta Predictions rat pricing
NM_133871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123752 predicted 792
2 SASI_Hs01_00123753 predicted 959
3 SASI_Hs01_00123754 predicted 1316
4 SASI_Hs01_00123755 predicted 1077
5 SASI_Hs02_00341528 predicted 1478
6 SASI_Hs01_00123756 predicted 1031
7 SASI_Hs01_00123758 predicted 493
8 SASI_Hs01_00123759 predicted 1166
9 SASI_Hs01_00123761 predicted 783
10 SASI_Hs02_00341529 predicted 1467
11 SASI_Hs01_00123757 predicted 937
12 SASI_Hs01_00123760 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231695 predicted 501
2 SASI_Rn02_00231696 predicted 626
3 SASI_Rn02_00231697 predicted 338
4 SASI_Rn02_00231698 predicted 1196
5 SASI_Rn02_00231699 predicted 1224
6 SASI_Rn02_00231700 predicted 1061
7 SASI_Rn02_00231701 predicted 362
8 SASI_Rn02_00231702 predicted 1521
9 SASI_Rn02_00231703 predicted 1131
10 SASI_Rn02_00231704 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154124 predicted 984
2 SASI_Mm01_00154127 predicted 844
3 SASI_Mm01_00154128 predicted 566
4 SASI_Mm02_00338929 predicted 650
5 SASI_Mm01_00154131 predicted 932
6 SASI_Mm02_00338930 predicted 862
7 SASI_Mm01_00154130 predicted 1312
8 SASI_Mm01_00154132 predicted 323
9 SASI_Mm01_00154133 predicted 836
10 SASI_Mm02_00338931 predicted 1176
11 SASI_Mm01_00154125 predicted 1072
12 SASI_Mm01_00154126 predicted 758
13 SASI_Mm01_00154129 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006417
VALIDATED
IFI44 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein 44
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006417.4-1462s21c1
Sequence:CCGGATGTGAAAGGTTCACGTAAATCTCGAGATTTACGTGAACCTTTCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-388s21c1
Sequence:CCGGAGAATGGAAACTAGGACTATGCTCGAGCATAGTCCTAGTTTCCATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-215s21c1
Sequence:CCGGAGTGTCCATGGATTCCGTAATCTCGAGATTACGGAATCCATGGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-1167s21c1
Sequence:CCGGTGGATAGCATGGATTTGATTACTCGAGTAATCAAATCCATGCTATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006417.2-1450s1c1
Sequence:CCGGCCTCACATCACAGAAGATTAACTCGAGTTAATCTTCTGTGATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006417.2-233s1c1
Sequence:CCGGGCCTACTCTAACAGTGATTTACTCGAGTAAATCACTGTTAGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006417.2-541s1c1
Sequence:CCGGGCGAAGATTCACTGGATGAAACTCGAGTTTCATCCAGTGAATCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006417.2-877s1c1
Sequence:CCGGGCAGGGATGACATATTCTATACTCGAGTATAGAATATGTCATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006417.2-1286s1c1
Sequence:CCGGCCCTGTAAAGGATGTTCTAATCTCGAGATTAGAACATCCTTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006417
VALIDATED
IFI44 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein 44
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006417.4-1462s21c1
Sequence:CCGGATGTGAAAGGTTCACGTAAATCTCGAGATTTACGTGAACCTTTCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-388s21c1
Sequence:CCGGAGAATGGAAACTAGGACTATGCTCGAGCATAGTCCTAGTTTCCATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-215s21c1
Sequence:CCGGAGTGTCCATGGATTCCGTAATCTCGAGATTACGGAATCCATGGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-1167s21c1
Sequence:CCGGTGGATAGCATGGATTTGATTACTCGAGTAATCAAATCCATGCTATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006417.2-1450s1c1
Sequence:CCGGCCTCACATCACAGAAGATTAACTCGAGTTAATCTTCTGTGATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006417.2-233s1c1
Sequence:CCGGGCCTACTCTAACAGTGATTTACTCGAGTAAATCACTGTTAGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006417.2-541s1c1
Sequence:CCGGGCGAAGATTCACTGGATGAAACTCGAGTTTCATCCAGTGAATCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006417.2-877s1c1
Sequence:CCGGGCAGGGATGACATATTCTATACTCGAGTATAGAATATGTCATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006417.2-1286s1c1
Sequence:CCGGCCCTGTAAAGGATGTTCTAATCTCGAGATTAGAACATCCTTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006417
VALIDATED
IFI44 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein 44
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006417.4-1462s21c1
Sequence:CCGGATGTGAAAGGTTCACGTAAATCTCGAGATTTACGTGAACCTTTCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-388s21c1
Sequence:CCGGAGAATGGAAACTAGGACTATGCTCGAGCATAGTCCTAGTTTCCATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-215s21c1
Sequence:CCGGAGTGTCCATGGATTCCGTAATCTCGAGATTACGGAATCCATGGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006417.4-1167s21c1
Sequence:CCGGTGGATAGCATGGATTTGATTACTCGAGTAATCAAATCCATGCTATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006417.2-1450s1c1
Sequence:CCGGCCTCACATCACAGAAGATTAACTCGAGTTAATCTTCTGTGATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006417.2-233s1c1
Sequence:CCGGGCCTACTCTAACAGTGATTTACTCGAGTAAATCACTGTTAGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006417.2-541s1c1
Sequence:CCGGGCGAAGATTCACTGGATGAAACTCGAGTTTCATCCAGTGAATCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006417.2-877s1c1
Sequence:CCGGGCAGGGATGACATATTCTATACTCGAGTATAGAATATGTCATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006417.2-1286s1c1
Sequence:CCGGCCCTGTAAAGGATGTTCTAATCTCGAGATTAGAACATCCTTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133871
IFI44 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133871.1-2137s1c1
Sequence:CCGGCCTCATTTATTTCTGCTTCATCTCGAGATGAAGCAGAAATAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-250s1c1
Sequence:CCGGGTTATTGGCATGTACCTGAAACTCGAGTTTCAGGTACATGCCAATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-310s1c1
Sequence:CCGGGCACTCCAAGAGACTGGATTTCTCGAGAAATCCAGTCTCTTGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-880s1c1
Sequence:CCGGCCTGACAGATACCAGTTCGATCTCGAGATCGAACTGGTATCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-466s1c1
Sequence:CCGGCGCAATAATGTCATACCTATTCTCGAGAATAGGTATGACATTATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133871
IFI44 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133871.1-2137s1c1
Sequence:CCGGCCTCATTTATTTCTGCTTCATCTCGAGATGAAGCAGAAATAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-250s1c1
Sequence:CCGGGTTATTGGCATGTACCTGAAACTCGAGTTTCAGGTACATGCCAATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-310s1c1
Sequence:CCGGGCACTCCAAGAGACTGGATTTCTCGAGAAATCCAGTCTCTTGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-880s1c1
Sequence:CCGGCCTGACAGATACCAGTTCGATCTCGAGATCGAACTGGTATCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-466s1c1
Sequence:CCGGCGCAATAATGTCATACCTATTCTCGAGAATAGGTATGACATTATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133871
IFI44 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133871.1-2137s1c1
Sequence:CCGGCCTCATTTATTTCTGCTTCATCTCGAGATGAAGCAGAAATAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-250s1c1
Sequence:CCGGGTTATTGGCATGTACCTGAAACTCGAGTTTCAGGTACATGCCAATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-310s1c1
Sequence:CCGGGCACTCCAAGAGACTGGATTTCTCGAGAAATCCAGTCTCTTGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-880s1c1
Sequence:CCGGCCTGACAGATACCAGTTCGATCTCGAGATCGAACTGGTATCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133871.1-466s1c1
Sequence:CCGGCGCAATAATGTCATACCTATTCTCGAGAATAGGTATGACATTATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)