EMAIL THIS PAGE TO A FRIEND

IFI44L

interferon-induced protein 44-like

74 Gene Product Result for
Synonyms: C1orf29
UniProtKB ID: Q53G44, Q86TE1, Q96B64, Q99984
Gene ID:
Mouse(15061) interferon-induced protein 44 like
Rat(310968) interferon-induced protein 44-like
dog(479980) interferon-induced protein 44-like
domestic cat(101090198) interferon-induced protein 44-like
cow(782879) interferon-induced protein 44-like
cow(508347) interferon-induced protein 44-like
sheep(101103357) interferon-induced protein 44-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030251 MISSION® esiRNA esiRNA human IFI44L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006820 Rosetta Predictions human pricing
XM_001079914 Rosetta Predictions rat pricing
XM_227820 Rosetta Predictions rat pricing
NM_031367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079579 predicted 1349
2 SASI_Hs01_00079580 predicted 412
3 SASI_Hs02_00342365 predicted 1296
4 SASI_Hs01_00079582 predicted 1133
5 SASI_Hs02_00342366 predicted 285
6 SASI_Hs01_00079584 predicted 1594
7 SASI_Hs01_00079585 predicted 649
8 SASI_Hs01_00079586 predicted 702
9 SASI_Hs02_00342367 predicted 1023
10 SASI_Hs02_00342368 predicted 1514
11 SASI_Hs01_00079581 predicted 1201
12 SASI_Hs01_00079583 predicted 821
13 SASI_Hs01_00079587 predicted 1053
14 SASI_Hs01_00079588 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365954 predicted 202
2 SASI_Rn02_00365955 predicted 1052
3 SASI_Rn02_00365956 predicted 476
4 SASI_Rn02_00365957 predicted 406
5 SASI_Rn02_00365958 predicted 551
6 SASI_Rn02_00365959 predicted 481
7 SASI_Rn02_00365960 predicted 1058
8 SASI_Rn02_00365961 predicted 1087
9 SASI_Rn02_00365962 predicted 529
10 SASI_Rn02_00365963 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384734 predicted 789
2 SASI_Rn02_00384735 predicted 803
3 SASI_Rn02_00384736 predicted 851
4 SASI_Rn02_00384737 predicted 748
5 SASI_Rn02_00384738 predicted 868
6 SASI_Rn02_00384739 predicted 746
7 SASI_Rn02_00384740 predicted 794
8 SASI_Rn02_00384741 predicted 750
9 SASI_Rn02_00384742 predicted 913
10 SASI_Rn02_00384743 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164091 predicted 1030
2 SASI_Mm01_00164092 predicted 1138
3 SASI_Mm01_00164094 predicted 1291
4 SASI_Mm01_00164095 predicted 1054
5 SASI_Mm02_00337102 predicted 206
6 SASI_Mm01_00164096 predicted 1273
7 SASI_Mm01_00164097 predicted 660
8 SASI_Mm01_00164098 predicted 1206
9 SASI_Mm01_00164099 predicted 787
10 SASI_Mm01_00164100 predicted 507
11 SASI_Mm01_00164093 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006820
VALIDATED
IFI44L MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein 44-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006820.1-1144s1c1
Sequence:CCGGGCAAGTTCACAAAGAAGTATTCTCGAGAATACTTCTTTGTGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006820.2-2662s21c1
Sequence:CCGGTGTGAAAGCTAGTACTATTAACTCGAGTTAATAGTACTAGCTTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-664s21c1
Sequence:CCGGAGGATAACCTAGACGACATAACTCGAGTTATGTCGTCTAGGTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006820.1-311s1c1
Sequence:CCGGGCCTTTATGCTTGGAAATTATCTCGAGATAATTTCCAAGCATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-894s21c1
Sequence:CCGGACCGAGCGGTATAGGATATATCTCGAGATATATCCTATACCGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-312s21c1
Sequence:CCGGAGCCGTCAGGGATGTACTATACTCGAGTATAGTACATCCCTGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006820.2-1326s21c1
Sequence:CCGGCGGGTCATGAATGTCCATAAACTCGAGTTTATGGACATTCATGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006820
VALIDATED
IFI44L MISSION shRNA shRNA Plasmid DNA
interferon-induced protein 44-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006820.1-1144s1c1
Sequence:CCGGGCAAGTTCACAAAGAAGTATTCTCGAGAATACTTCTTTGTGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006820.2-2662s21c1
Sequence:CCGGTGTGAAAGCTAGTACTATTAACTCGAGTTAATAGTACTAGCTTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-664s21c1
Sequence:CCGGAGGATAACCTAGACGACATAACTCGAGTTATGTCGTCTAGGTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006820.1-311s1c1
Sequence:CCGGGCCTTTATGCTTGGAAATTATCTCGAGATAATTTCCAAGCATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-894s21c1
Sequence:CCGGACCGAGCGGTATAGGATATATCTCGAGATATATCCTATACCGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-312s21c1
Sequence:CCGGAGCCGTCAGGGATGTACTATACTCGAGTATAGTACATCCCTGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006820.2-1326s21c1
Sequence:CCGGCGGGTCATGAATGTCCATAAACTCGAGTTTATGGACATTCATGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006820
VALIDATED
IFI44L MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein 44-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006820.1-1144s1c1
Sequence:CCGGGCAAGTTCACAAAGAAGTATTCTCGAGAATACTTCTTTGTGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006820.2-2662s21c1
Sequence:CCGGTGTGAAAGCTAGTACTATTAACTCGAGTTAATAGTACTAGCTTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-664s21c1
Sequence:CCGGAGGATAACCTAGACGACATAACTCGAGTTATGTCGTCTAGGTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006820.1-311s1c1
Sequence:CCGGGCCTTTATGCTTGGAAATTATCTCGAGATAATTTCCAAGCATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-894s21c1
Sequence:CCGGACCGAGCGGTATAGGATATATCTCGAGATATATCCTATACCGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006820.2-312s21c1
Sequence:CCGGAGCCGTCAGGGATGTACTATACTCGAGTATAGTACATCCCTGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006820.2-1326s21c1
Sequence:CCGGCGGGTCATGAATGTCCATAAACTCGAGTTTATGGACATTCATGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031367
IFI44L MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein 44-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-166s21c1
Sequence:CCGGTATCAGTCCAGTGCTCATAAACTCGAGTTTATGAGCACTGGACTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-666s21c1
Sequence:CCGGGGTTTCAGAAGGTTCGTATTCCTCGAGGAATACGAACCTTCTGAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031367.1-1922s21c1
Sequence:CCGGCAACTCTATGTACCGGAATTGCTCGAGCAATTCCGGTACATAGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-400s21c1
Sequence:CCGGGACTCTGAAGAGCTGATAATTCTCGAGAATTATCAGCTCTTCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-862s21c1
Sequence:CCGGTTTATGCTGTGTGATTCAATGCTCGAGCATTGAATCACACAGCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031367
IFI44L MISSION shRNA shRNA Plasmid DNA
interferon-induced protein 44-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-166s21c1
Sequence:CCGGTATCAGTCCAGTGCTCATAAACTCGAGTTTATGAGCACTGGACTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-666s21c1
Sequence:CCGGGGTTTCAGAAGGTTCGTATTCCTCGAGGAATACGAACCTTCTGAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031367.1-1922s21c1
Sequence:CCGGCAACTCTATGTACCGGAATTGCTCGAGCAATTCCGGTACATAGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-400s21c1
Sequence:CCGGGACTCTGAAGAGCTGATAATTCTCGAGAATTATCAGCTCTTCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-862s21c1
Sequence:CCGGTTTATGCTGTGTGATTCAATGCTCGAGCATTGAATCACACAGCATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031367
IFI44L MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein 44-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-166s21c1
Sequence:CCGGTATCAGTCCAGTGCTCATAAACTCGAGTTTATGAGCACTGGACTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-666s21c1
Sequence:CCGGGGTTTCAGAAGGTTCGTATTCCTCGAGGAATACGAACCTTCTGAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031367.1-1922s21c1
Sequence:CCGGCAACTCTATGTACCGGAATTGCTCGAGCAATTCCGGTACATAGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-400s21c1
Sequence:CCGGGACTCTGAAGAGCTGATAATTCTCGAGAATTATCAGCTCTTCAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031367.1-862s21c1
Sequence:CCGGTTTATGCTGTGTGATTCAATGCTCGAGCATTGAATCACACAGCATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)