EMAIL THIS PAGE TO A FRIEND

IFI6

interferon, alpha-inducible protein 6

45 Gene Product Result for
Synonyms: 6-16 FAM14C G1P3 IFI-6-16 IFI616
Gene ID:
Human(2537) Summary: This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described. [provided by RefSeq, Jul 2008]
sheep(101106828) interferon, alpha-inducible protein 6
dog(478170) interferon, alpha-inducible protein 6
cow(512913) interferon, alpha-inducible protein 6
domestic cat(101089878) interferon, alpha-inducible protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002038 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124141 MISSION® esiRNA esiRNA human IFI6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002038 Rosetta Predictions human pricing
NM_022872 Rosetta Predictions human pricing
NM_022873 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027156 predicted 123
2 SASI_Hs01_00027157 predicted 124
3 SASI_Hs01_00027158 predicted 480
4 SASI_Hs01_00027159 predicted 479
5 SASI_Hs01_00027160 predicted 762
6 SASI_Hs01_00027161 predicted 472
7 SASI_Hs01_00027162 predicted 478
8 SASI_Hs01_00027164 predicted 752
9 SASI_Hs01_00027165 predicted 787
10 SASI_Hs02_00333067 predicted 540
11 SASI_Hs01_00027163 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040607 predicted 119
2 SASI_Hs01_00040608 predicted 123
3 SASI_Hs01_00040609 predicted 491
4 SASI_Hs01_00040611 predicted 493
5 SASI_Hs01_00040612 predicted 774
6 SASI_Hs01_00040613 predicted 490
7 SASI_Hs01_00040614 predicted 481
8 SASI_Hs01_00040615 predicted 190
9 SASI_Hs02_00356163 predicted 764
10 SASI_Hs02_00356164 predicted 553
11 SASI_Hs01_00040610 predicted 190
12 SASI_Hs01_00040616 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218189 predicted 200
2 SASI_Hs01_00218190 predicted 123
3 SASI_Hs01_00218191 predicted 200
4 SASI_Hs01_00218192 predicted 205
5 SASI_Hs01_00218193 predicted 196
6 SASI_Hs01_00218194 predicted 119
7 SASI_Hs01_00218195 predicted 193
8 SASI_Hs01_00218197 predicted 504
9 SASI_Hs01_00218198 predicted 504
10 SASI_Hs02_00356165 predicted 781
11 SASI_Hs01_00218196 predicted 186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002038
IFI6 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha-inducible protein 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002038.2-635s1c1
Sequence:CCGGGCTATTCACAGATGCGAACATCTCGAGATGTTCGCATCTGTGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002038.3-537s21c1
Sequence:CCGGTTCTTCCTTCTTGGCCTAACTCTCGAGAGTTAGGCCAAGAAGGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002038.3-562s21c1
Sequence:CCGGCAGTTAGGATCTAGAACTTTGCTCGAGCAAAGTTCTAGATCCTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002038.3-155s21c1
Sequence:CCGGGCTACCTGCTGCTCTTCACTTCTCGAGAAGTGAAGAGCAGCAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-467s1c1
Sequence:CCGGCAAGTATCTCGATAGTGAGGACTCGAGTCCTCACTATCGAGATACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-428s1c1
Sequence:CCGGCATAGGTAATATTGGTGCCCTCTCGAGAGGGCACCAATATTACCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-465s1c1
Sequence:CCGGCACAAGTATCTCGATAGTGAGCTCGAGCTCACTATCGAGATACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-419s1c1
Sequence:CCGGCAGCGTCGTCATAGGTAATATCTCGAGATATTACCTATGACGACGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002038
IFI6 MISSION shRNA shRNA Plasmid DNA
interferon, alpha-inducible protein 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002038.2-635s1c1
Sequence:CCGGGCTATTCACAGATGCGAACATCTCGAGATGTTCGCATCTGTGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002038.3-537s21c1
Sequence:CCGGTTCTTCCTTCTTGGCCTAACTCTCGAGAGTTAGGCCAAGAAGGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002038.3-562s21c1
Sequence:CCGGCAGTTAGGATCTAGAACTTTGCTCGAGCAAAGTTCTAGATCCTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002038.3-155s21c1
Sequence:CCGGGCTACCTGCTGCTCTTCACTTCTCGAGAAGTGAAGAGCAGCAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-467s1c1
Sequence:CCGGCAAGTATCTCGATAGTGAGGACTCGAGTCCTCACTATCGAGATACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-428s1c1
Sequence:CCGGCATAGGTAATATTGGTGCCCTCTCGAGAGGGCACCAATATTACCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-465s1c1
Sequence:CCGGCACAAGTATCTCGATAGTGAGCTCGAGCTCACTATCGAGATACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-419s1c1
Sequence:CCGGCAGCGTCGTCATAGGTAATATCTCGAGATATTACCTATGACGACGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002038
IFI6 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha-inducible protein 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002038.2-635s1c1
Sequence:CCGGGCTATTCACAGATGCGAACATCTCGAGATGTTCGCATCTGTGAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002038.3-537s21c1
Sequence:CCGGTTCTTCCTTCTTGGCCTAACTCTCGAGAGTTAGGCCAAGAAGGAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002038.3-562s21c1
Sequence:CCGGCAGTTAGGATCTAGAACTTTGCTCGAGCAAAGTTCTAGATCCTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002038.3-155s21c1
Sequence:CCGGGCTACCTGCTGCTCTTCACTTCTCGAGAAGTGAAGAGCAGCAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-467s1c1
Sequence:CCGGCAAGTATCTCGATAGTGAGGACTCGAGTCCTCACTATCGAGATACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-428s1c1
Sequence:CCGGCATAGGTAATATTGGTGCCCTCTCGAGAGGGCACCAATATTACCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-465s1c1
Sequence:CCGGCACAAGTATCTCGATAGTGAGCTCGAGCTCACTATCGAGATACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002038.2-419s1c1
Sequence:CCGGCAGCGTCGTCATAGGTAATATCTCGAGATATTACCTATGACGACGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)