EMAIL THIS PAGE TO A FRIEND

IFIH1

interferon induced with helicase C domain 1

61 Gene Product Result for
Synonyms: Hlcd IDDM19 MDA-5 MDA5 RLR-2
UniProtKB ID: Q9BYX4, Q2NKL6, Q6DC96, Q86X56, Q96MX8, Q9H3G6
Gene ID:
Human(64135) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
Mouse(71586) interferon induced with helicase C domain 1
Rat(499801) interferon induced with helicase C domain 1
chicken(424185) interferon induced with helicase C domain 1
dog(488371) interferon induced with helicase C domain 1
cow(535490) interferon induced with helicase C domain 1
Horse(100061257) interferon induced with helicase C domain 1
domestic cat(101099233) interferon induced with helicase C domain 1
sheep(101106234) interferon induced with helicase C domain 1
domestic guinea pig(100717607) interferon induced with helicase C domain 1
naked mole-rat(101721395) interferon induced with helicase C domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022168 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022168 Rosetta Predictions human pricing
NM_001109199 Rosetta Predictions rat pricing
NM_027835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171929 predicted 2533
2 SASI_Hs01_00171930 predicted 1294
3 SASI_Hs01_00171931 predicted 3142
4 SASI_Hs02_00355601 predicted 1575
5 SASI_Hs01_00171932 predicted 1494
6 SASI_Hs01_00171933 predicted 1720
7 SASI_Hs01_00171934 predicted 3020
8 SASI_Hs01_00171935 predicted 3119
9 SASI_Hs01_00171936 predicted 250
10 SASI_Hs01_00171937 predicted 3064
11 SASI_Hs01_00171938 predicted 3016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246070 predicted 1292
2 SASI_Rn02_00246071 predicted 2542
3 SASI_Rn02_00246072 predicted 2627
4 SASI_Rn02_00246073 predicted 252
5 SASI_Rn02_00246074 predicted 3245
6 SASI_Rn02_00246075 predicted 2193
7 SASI_Rn02_00246076 predicted 692
8 SASI_Rn02_00246077 predicted 1345
9 SASI_Rn02_00246078 predicted 777
10 SASI_Rn02_00246079 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332785 predicted 1801
2 SASI_Mm01_00044546 predicted 2551
3 SASI_Mm02_00332786 predicted 654
4 SASI_Mm01_00044548 predicted 706
5 SASI_Mm01_00044549 predicted 2358
6 SASI_Mm01_00044550 predicted 1308
7 SASI_Mm01_00044551 predicted 2345
8 SASI_Mm01_00044552 predicted 3139
9 SASI_Mm01_00044553 predicted 2195
10 SASI_Mm01_00044554 predicted 2624
11 SASI_Mm01_00044547 predicted 3007
12 SASI_Mm01_00044555 predicted 2797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027835
VALIDATED
IFIH1 MISSION shRNA Bacterial Glycerol Stock
interferon induced with helicase C domain 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-994s21c1
Sequence:CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-3261s21c1
Sequence:CCGGCCTGATCTTGACTACTCAGAACTCGAGTTCTGAGTAGTCAAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-2063s21c1
Sequence:CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027835.2-3543s21c1
Sequence:CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-3547s1c1
Sequence:CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-998s1c1
Sequence:CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-2911s1c1
Sequence:CCGGGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-2067s1c1
Sequence:CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027835.1-3265s1c1
Sequence:CCGGCCTGATCTTGACTACTCAGAACTCGAGTTCTGAGTAGTCAAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027835
VALIDATED
IFIH1 MISSION shRNA shRNA Plasmid DNA
interferon induced with helicase C domain 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-994s21c1
Sequence:CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-3261s21c1
Sequence:CCGGCCTGATCTTGACTACTCAGAACTCGAGTTCTGAGTAGTCAAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-2063s21c1
Sequence:CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027835.2-3543s21c1
Sequence:CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-3547s1c1
Sequence:CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-998s1c1
Sequence:CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-2911s1c1
Sequence:CCGGGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-2067s1c1
Sequence:CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027835.1-3265s1c1
Sequence:CCGGCCTGATCTTGACTACTCAGAACTCGAGTTCTGAGTAGTCAAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027835
VALIDATED
IFIH1 MISSION shRNA Lentiviral Transduction Particles
interferon induced with helicase C domain 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-994s21c1
Sequence:CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-3261s21c1
Sequence:CCGGCCTGATCTTGACTACTCAGAACTCGAGTTCTGAGTAGTCAAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027835.2-2063s21c1
Sequence:CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027835.2-3543s21c1
Sequence:CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-3547s1c1
Sequence:CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-998s1c1
Sequence:CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-2911s1c1
Sequence:CCGGGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027835.1-2067s1c1
Sequence:CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027835.1-3265s1c1
Sequence:CCGGCCTGATCTTGACTACTCAGAACTCGAGTTCTGAGTAGTCAAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022168
VALIDATED
IFIH1 MISSION shRNA Bacterial Glycerol Stock
interferon induced with helicase C domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-1586s21c1
Sequence:CCGGATAACATCATGAGGCATTATTCTCGAGAATAATGCCTCATGATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2072s21c1
Sequence:CCGGTTCGAATGATAGATGCGTATACTCGAGTATACGCATCTATCATTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2040s21c1
Sequence:CCGGGTACAATGAGGCCCTACAAATCTCGAGATTTGTAGGGCCTCATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-708s21c1
Sequence:CCGGAGGTGTAAGAGAGCTACTAAACTCGAGTTTAGTAGCTCTCTTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-535s1c1
Sequence:CCGGCCATCGTTTGAGAACGCTCATCTCGAGATGAGCGTTCTCAAACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2369s21c1
Sequence:CCGGAGGAATCAGCACGAGGAATAACTCGAGTTATTCCTCGTGCTGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_022168.2-1342s1c1
Sequence:CCGGCGCAAGGAGTTCCAACCATTTCTCGAGAAATGGTTGGAACTCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-1565s1c1
Sequence:CCGGCCAACAAAGAAGCAGTGTATACTCGAGTATACACTGCTTCTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-2515s1c1
Sequence:CCGGCCCATGACACAGAATGAACAACTCGAGTTGTTCATTCTGTGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022168
VALIDATED
IFIH1 MISSION shRNA shRNA Plasmid DNA
interferon induced with helicase C domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-1586s21c1
Sequence:CCGGATAACATCATGAGGCATTATTCTCGAGAATAATGCCTCATGATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2072s21c1
Sequence:CCGGTTCGAATGATAGATGCGTATACTCGAGTATACGCATCTATCATTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2040s21c1
Sequence:CCGGGTACAATGAGGCCCTACAAATCTCGAGATTTGTAGGGCCTCATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-708s21c1
Sequence:CCGGAGGTGTAAGAGAGCTACTAAACTCGAGTTTAGTAGCTCTCTTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-535s1c1
Sequence:CCGGCCATCGTTTGAGAACGCTCATCTCGAGATGAGCGTTCTCAAACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2369s21c1
Sequence:CCGGAGGAATCAGCACGAGGAATAACTCGAGTTATTCCTCGTGCTGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_022168.2-1342s1c1
Sequence:CCGGCGCAAGGAGTTCCAACCATTTCTCGAGAAATGGTTGGAACTCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-1565s1c1
Sequence:CCGGCCAACAAAGAAGCAGTGTATACTCGAGTATACACTGCTTCTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-2515s1c1
Sequence:CCGGCCCATGACACAGAATGAACAACTCGAGTTGTTCATTCTGTGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022168
VALIDATED
IFIH1 MISSION shRNA Lentiviral Transduction Particles
interferon induced with helicase C domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-1586s21c1
Sequence:CCGGATAACATCATGAGGCATTATTCTCGAGAATAATGCCTCATGATGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2072s21c1
Sequence:CCGGTTCGAATGATAGATGCGTATACTCGAGTATACGCATCTATCATTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2040s21c1
Sequence:CCGGGTACAATGAGGCCCTACAAATCTCGAGATTTGTAGGGCCTCATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-708s21c1
Sequence:CCGGAGGTGTAAGAGAGCTACTAAACTCGAGTTTAGTAGCTCTCTTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-535s1c1
Sequence:CCGGCCATCGTTTGAGAACGCTCATCTCGAGATGAGCGTTCTCAAACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022168.2-2369s21c1
Sequence:CCGGAGGAATCAGCACGAGGAATAACTCGAGTTATTCCTCGTGCTGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_022168.2-1342s1c1
Sequence:CCGGCGCAAGGAGTTCCAACCATTTCTCGAGAAATGGTTGGAACTCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-1565s1c1
Sequence:CCGGCCAACAAAGAAGCAGTGTATACTCGAGTATACACTGCTTCTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022168.2-2515s1c1
Sequence:CCGGCCCATGACACAGAATGAACAACTCGAGTTGTTCATTCTGTGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)