EMAIL THIS PAGE TO A FRIEND

IFIT1

interferon-induced protein with tetratricopeptide repeats 1

65 Gene Product Result for
Synonyms: C56 G10P1 IFI-56 IFI-56K IFI56 IFIT-1 IFNAI1 ISG56 P56 RNM561
UniProtKB ID: P09914, Q5T7J1, Q96QM5
Gene ID:
Human(3434) Summary: This gene encodes a protein containing tetratricopeptide repeats that was originally identified as induced upon treatment with interferon. The encoded protein may inhibit viral replication and translational initiation. This gene is located in a cluster on chromosome 10 with five other closely related genes. There is a pseudogene for this gene on chromosome 13. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
Mouse(15957) interferon-induced protein with tetratricopeptide repeats 1
Rat(56824) interferon-induced protein with tetratricopeptide repeats 1
naked mole-rat(101701903) interferon-induced protein with tetratricopeptide repeats 1
sheep(101102194) interferon-induced protein with tetratricopeptide repeats 1
dog(488947) interferon-induced protein with tetratricopeptide repeats 1
Horse(100058990) interferon-induced protein with tetratricopeptide repeats 1
cow(100139670) interferon-induced protein with tetratricopeptide repeats 1
domestic cat(101094376) interferon-induced protein with tetratricopeptide repeats 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143151 MISSION® esiRNA esiRNA human IFIT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001887 Rosetta Predictions human pricing
NM_001548 Rosetta Predictions human pricing
NM_020096 Rosetta Predictions rat pricing
NM_008331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149217 predicted 838
2 SASI_Hs01_00149218 predicted 1236
3 SASI_Hs01_00149219 predicted 1109
4 SASI_Hs01_00149220 predicted 1435
5 SASI_Hs01_00149221 predicted 1320
6 SASI_Hs01_00149222 predicted 344
7 SASI_Hs01_00149223 predicted 939
8 SASI_Hs01_00149224 predicted 941
9 SASI_Hs01_00149225 predicted 1205
10 SASI_Hs01_00149226 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017406 predicted 644
2 SASI_Hs02_00332092 predicted 1398
3 SASI_Hs02_00332093 predicted 895
4 SASI_Hs02_00332094 predicted 1290
5 SASI_Hs02_00332095 predicted 786
6 SASI_Hs02_00332096 predicted 1376
7 SASI_Hs01_00017404 predicted 389
8 SASI_Hs01_00017409 predicted 205
9 SASI_Hs02_00332097 predicted 990
10 SASI_Hs02_00332098 predicted 1255
11 SASI_Hs01_00017405 predicted 635
12 SASI_Hs01_00017407 predicted 588
13 SASI_Hs01_00017408 predicted 467
14 SASI_Hs01_00017410 predicted 216
15 SASI_Hs01_00017411 predicted 457
16 SASI_Hs01_00017412 predicted 240
17 SASI_Hs01_00017413 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097591 predicted 441
2 SASI_Rn01_00097592 predicted 817
3 SASI_Rn01_00097593 predicted 1172
4 SASI_Rn01_00097595 predicted 602
5 SASI_Rn02_00262503 predicted 1491
6 SASI_Rn02_00262504 predicted 1484
7 SASI_Rn01_00097596 predicted 1061
8 SASI_Rn01_00097597 predicted 1325
9 SASI_Rn01_00097598 predicted 1506
10 SASI_Rn01_00097599 predicted 1077
11 SASI_Rn01_00097594 predicted 1487
12 SASI_Rn01_00097600 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142588 predicted 954
2 SASI_Mm02_00313665 predicted 1457
3 SASI_Mm01_00142589 predicted 1110
4 SASI_Mm01_00142590 predicted 1072
5 SASI_Mm01_00142591 predicted 1133
6 SASI_Mm01_00142592 predicted 834
7 SASI_Mm01_00142593 predicted 1066
8 SASI_Mm01_00142594 predicted 1324
9 SASI_Mm01_00142595 predicted 832
10 SASI_Mm01_00142596 predicted 1277
11 SASI_Mm01_00142597 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001548
VALIDATED
IFIT1 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-328s1c1
Sequence:CCGGCCAAGCAAATGTGAGGAGTCTCTCGAGAGACTCCTCACATTTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-696s1c1
Sequence:CCGGGCTTAAATCCAGACAATGGATCTCGAGATCCATTGTCTGGATTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001548.1-134s1c1
Sequence:CCGGGAGTTATCCATTGATGACGATCTCGAGATCGTCATCAATGGATAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-908s1c1
Sequence:CCGGCCCACTTCTGTCTTACTGCATCTCGAGATGCAGTAAGACAGAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001548.1-205s1c1
Sequence:CCGGCACCAAATACAGTGTGGGAATCTCGAGATTCCCACACTGTATTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1352s1c1
Sequence:CCGGCTTCGGAGAAAGGCATTAGATCTCGAGATCTAATGCCTTTCTCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1295s1c1
Sequence:CCGGGCATCATTAACAAGGGATAAACTCGAGTTTATCCCTTGTTAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1195s1c1
Sequence:CCGGGCAAGACATACATTTCTACTACTCGAGTAGTAGAAATGTATGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-149s1c1
Sequence:CCGGGACGATGAAATGCCTGATTTACTCGAGTAAATCAGGCATTTCATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1249s1c1
Sequence:CCGGCGTCAATGCAATTATCCATTACTCGAGTAATGGATAATTGCATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-120s1c1
Sequence:CCGGGTCACTTTACATGGGAGTTATCTCGAGATAACTCCCATGTAAAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1594s21c1
Sequence:CCGGATATCAGCCACTTTCACATTTCTCGAGAAATGTGAAAGTGGCTGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-1509s21c1
Sequence:CCGGATGAAGCCCTGGAGTACTATGCTCGAGCATAGTACTCCAGGGCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1680s21c1
Sequence:CCGGTTCACTGTAATGATGTAATTCCTCGAGGAATTACATCATTACAGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1602s21c1
Sequence:CCGGCACTTTCACATTTCATTTCATCTCGAGATGAAATGAAATGTGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-1110s21c1
Sequence:CCGGTGATAAGATCAGCCATATTTCCTCGAGGAAATATGGCTGATCTTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-896s21c1
Sequence:CCGGCAGACCTATGTCTTTCGATATCTCGAGATATCGAAAGACATAGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001548
VALIDATED
IFIT1 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-328s1c1
Sequence:CCGGCCAAGCAAATGTGAGGAGTCTCTCGAGAGACTCCTCACATTTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-696s1c1
Sequence:CCGGGCTTAAATCCAGACAATGGATCTCGAGATCCATTGTCTGGATTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001548.1-134s1c1
Sequence:CCGGGAGTTATCCATTGATGACGATCTCGAGATCGTCATCAATGGATAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-908s1c1
Sequence:CCGGCCCACTTCTGTCTTACTGCATCTCGAGATGCAGTAAGACAGAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001548.1-205s1c1
Sequence:CCGGCACCAAATACAGTGTGGGAATCTCGAGATTCCCACACTGTATTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1352s1c1
Sequence:CCGGCTTCGGAGAAAGGCATTAGATCTCGAGATCTAATGCCTTTCTCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1295s1c1
Sequence:CCGGGCATCATTAACAAGGGATAAACTCGAGTTTATCCCTTGTTAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1195s1c1
Sequence:CCGGGCAAGACATACATTTCTACTACTCGAGTAGTAGAAATGTATGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-149s1c1
Sequence:CCGGGACGATGAAATGCCTGATTTACTCGAGTAAATCAGGCATTTCATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1249s1c1
Sequence:CCGGCGTCAATGCAATTATCCATTACTCGAGTAATGGATAATTGCATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-120s1c1
Sequence:CCGGGTCACTTTACATGGGAGTTATCTCGAGATAACTCCCATGTAAAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1594s21c1
Sequence:CCGGATATCAGCCACTTTCACATTTCTCGAGAAATGTGAAAGTGGCTGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-1509s21c1
Sequence:CCGGATGAAGCCCTGGAGTACTATGCTCGAGCATAGTACTCCAGGGCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1680s21c1
Sequence:CCGGTTCACTGTAATGATGTAATTCCTCGAGGAATTACATCATTACAGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1602s21c1
Sequence:CCGGCACTTTCACATTTCATTTCATCTCGAGATGAAATGAAATGTGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-1110s21c1
Sequence:CCGGTGATAAGATCAGCCATATTTCCTCGAGGAAATATGGCTGATCTTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-896s21c1
Sequence:CCGGCAGACCTATGTCTTTCGATATCTCGAGATATCGAAAGACATAGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001548
VALIDATED
IFIT1 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-328s1c1
Sequence:CCGGCCAAGCAAATGTGAGGAGTCTCTCGAGAGACTCCTCACATTTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-696s1c1
Sequence:CCGGGCTTAAATCCAGACAATGGATCTCGAGATCCATTGTCTGGATTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001548.1-134s1c1
Sequence:CCGGGAGTTATCCATTGATGACGATCTCGAGATCGTCATCAATGGATAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-908s1c1
Sequence:CCGGCCCACTTCTGTCTTACTGCATCTCGAGATGCAGTAAGACAGAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001548.1-205s1c1
Sequence:CCGGCACCAAATACAGTGTGGGAATCTCGAGATTCCCACACTGTATTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1352s1c1
Sequence:CCGGCTTCGGAGAAAGGCATTAGATCTCGAGATCTAATGCCTTTCTCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1295s1c1
Sequence:CCGGGCATCATTAACAAGGGATAAACTCGAGTTTATCCCTTGTTAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1195s1c1
Sequence:CCGGGCAAGACATACATTTCTACTACTCGAGTAGTAGAAATGTATGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-149s1c1
Sequence:CCGGGACGATGAAATGCCTGATTTACTCGAGTAAATCAGGCATTTCATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001548.1-1249s1c1
Sequence:CCGGCGTCAATGCAATTATCCATTACTCGAGTAATGGATAATTGCATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001548.1-120s1c1
Sequence:CCGGGTCACTTTACATGGGAGTTATCTCGAGATAACTCCCATGTAAAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1594s21c1
Sequence:CCGGATATCAGCCACTTTCACATTTCTCGAGAAATGTGAAAGTGGCTGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-1509s21c1
Sequence:CCGGATGAAGCCCTGGAGTACTATGCTCGAGCATAGTACTCCAGGGCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1680s21c1
Sequence:CCGGTTCACTGTAATGATGTAATTCCTCGAGGAATTACATCATTACAGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001548.3-1602s21c1
Sequence:CCGGCACTTTCACATTTCATTTCATCTCGAGATGAAATGAAATGTGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-1110s21c1
Sequence:CCGGTGATAAGATCAGCCATATTTCCTCGAGGAAATATGGCTGATCTTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001548.3-896s21c1
Sequence:CCGGCAGACCTATGTCTTTCGATATCTCGAGATATCGAAAGACATAGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008331
VALIDATED
IFIT1 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008331.1-1665s1c1
Sequence:CCGGCCAAGGATACATACTCACTTACTCGAGTAAGTGAGTATGTATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-1045s1c1
Sequence:CCGGCCCACATTTGAGATGGCCTATCTCGAGATAGGCCATCTCAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008331.1-1156s1c1
Sequence:CCGGGCTCACATAGAGCAGGATATTCTCGAGAATATCCTGCTCTATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-621s1c1
Sequence:CCGGCCAAGATTTAGATGACAACTTCTCGAGAAGTTGTCATCTAAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-814s1c1
Sequence:CCGGGCCAAATATTTCCGTAGGAAACTCGAGTTTCCTACGGAAATATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008331.3-1493s21c1
Sequence:CCGGCTCACCTCTGTGACGTTAATACTCGAGTATTAACGTCACAGAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-686s21c1
Sequence:CCGGAGGAAGGCTGTCCGGTTAAATCTCGAGATTTAACCGGACAGCCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1181s21c1
Sequence:CCGGGCTCACATAGAGCAGGATATTCTCGAGAATATCCTGCTCTATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008331.3-1678s21c1
Sequence:CCGGCCAAGGATACATACTCACTTACTCGAGTAAGTGAGTATGTATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-827s21c1
Sequence:CCGGATTCGCTATGCAGCCAAATATCTCGAGATATTTGGCTGCATAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1252s21c1
Sequence:CCGGGGCAATCACCCTCTACTTAAACTCGAGTTTAAGTAGAGGGTGATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1028s21c1
Sequence:CCGGCAACAGGCCATTCATGAATTTCTCGAGAAATTCATGAATGGCCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1333s21c1
Sequence:CCGGAGTGGCTGAAAGACGTGTTTGCTCGAGCAAACACGTCTTTCAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008331
VALIDATED
IFIT1 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008331.1-1665s1c1
Sequence:CCGGCCAAGGATACATACTCACTTACTCGAGTAAGTGAGTATGTATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-1045s1c1
Sequence:CCGGCCCACATTTGAGATGGCCTATCTCGAGATAGGCCATCTCAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008331.1-1156s1c1
Sequence:CCGGGCTCACATAGAGCAGGATATTCTCGAGAATATCCTGCTCTATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-621s1c1
Sequence:CCGGCCAAGATTTAGATGACAACTTCTCGAGAAGTTGTCATCTAAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-814s1c1
Sequence:CCGGGCCAAATATTTCCGTAGGAAACTCGAGTTTCCTACGGAAATATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008331.3-1493s21c1
Sequence:CCGGCTCACCTCTGTGACGTTAATACTCGAGTATTAACGTCACAGAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-686s21c1
Sequence:CCGGAGGAAGGCTGTCCGGTTAAATCTCGAGATTTAACCGGACAGCCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1181s21c1
Sequence:CCGGGCTCACATAGAGCAGGATATTCTCGAGAATATCCTGCTCTATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008331.3-1678s21c1
Sequence:CCGGCCAAGGATACATACTCACTTACTCGAGTAAGTGAGTATGTATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-827s21c1
Sequence:CCGGATTCGCTATGCAGCCAAATATCTCGAGATATTTGGCTGCATAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1252s21c1
Sequence:CCGGGGCAATCACCCTCTACTTAAACTCGAGTTTAAGTAGAGGGTGATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1028s21c1
Sequence:CCGGCAACAGGCCATTCATGAATTTCTCGAGAAATTCATGAATGGCCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1333s21c1
Sequence:CCGGAGTGGCTGAAAGACGTGTTTGCTCGAGCAAACACGTCTTTCAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008331
VALIDATED
IFIT1 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008331.1-1665s1c1
Sequence:CCGGCCAAGGATACATACTCACTTACTCGAGTAAGTGAGTATGTATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-1045s1c1
Sequence:CCGGCCCACATTTGAGATGGCCTATCTCGAGATAGGCCATCTCAAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008331.1-1156s1c1
Sequence:CCGGGCTCACATAGAGCAGGATATTCTCGAGAATATCCTGCTCTATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-621s1c1
Sequence:CCGGCCAAGATTTAGATGACAACTTCTCGAGAAGTTGTCATCTAAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008331.1-814s1c1
Sequence:CCGGGCCAAATATTTCCGTAGGAAACTCGAGTTTCCTACGGAAATATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008331.3-1493s21c1
Sequence:CCGGCTCACCTCTGTGACGTTAATACTCGAGTATTAACGTCACAGAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-686s21c1
Sequence:CCGGAGGAAGGCTGTCCGGTTAAATCTCGAGATTTAACCGGACAGCCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1181s21c1
Sequence:CCGGGCTCACATAGAGCAGGATATTCTCGAGAATATCCTGCTCTATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008331.3-1678s21c1
Sequence:CCGGCCAAGGATACATACTCACTTACTCGAGTAAGTGAGTATGTATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-827s21c1
Sequence:CCGGATTCGCTATGCAGCCAAATATCTCGAGATATTTGGCTGCATAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1252s21c1
Sequence:CCGGGGCAATCACCCTCTACTTAAACTCGAGTTTAAGTAGAGGGTGATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1028s21c1
Sequence:CCGGCAACAGGCCATTCATGAATTTCTCGAGAAATTCATGAATGGCCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008331.3-1333s21c1
Sequence:CCGGAGTGGCTGAAAGACGTGTTTGCTCGAGCAAACACGTCTTTCAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)