EMAIL THIS PAGE TO A FRIEND

IFIT1B

interferon-induced protein with tetratricopeptide repeats 1B

18 Gene Product Result for
Synonyms: IFIT1L bA149I23.6
UniProtKB ID: Q5T764, A7E245
Gene ID:
dog(606817) interferon-induced protein with tetratricopeptide repeats 1B
Horse(100066067) interferon-induced protein with tetratricopeptide repeats 1B
domestic cat(101099658) interferon-induced protein with tetratricopeptide repeats 1B
domestic guinea pig(100736229) interferon-induced protein with tetratricopeptide repeats 1B
naked mole-rat(101715397) interferon-induced protein with tetratricopeptide repeats 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010987 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104041 MISSION® esiRNA esiRNA human IFIT1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010987 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129436 predicted 625
2 SASI_Hs01_00129437 predicted 308
3 SASI_Hs01_00129438 predicted 461
4 SASI_Hs01_00129439 predicted 1263
5 SASI_Hs01_00129440 predicted 1182
6 SASI_Hs01_00129441 predicted 1090
7 SASI_Hs01_00129442 predicted 507
8 SASI_Hs01_00129443 predicted 1048
9 SASI_Hs01_00129444 predicted 1329
10 SASI_Hs01_00129445 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010987
IFIT1B MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1211s1c1
Sequence:CCGGGCAAGAGATTCATTACCACTACTCGAGTAGTGGTAATGAATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010987.1-1739s1c1
Sequence:CCGGCCTGATGGAATGGTAAAGCAACTCGAGTTGCTTTACCATTCCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1172s1c1
Sequence:CCGGGAAAGGGTTACGCATGAAGATCTCGAGATCTTCATGCGTAACCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-708s1c1
Sequence:CCGGGTCAGGCTAAATCCAGATGATCTCGAGATCATCTGGATTTAGCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1406s1c1
Sequence:CCGGCCTTGGGCTTATCCACAAATTCTCGAGAATTTGTGGATAAGCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010987
IFIT1B MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1211s1c1
Sequence:CCGGGCAAGAGATTCATTACCACTACTCGAGTAGTGGTAATGAATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010987.1-1739s1c1
Sequence:CCGGCCTGATGGAATGGTAAAGCAACTCGAGTTGCTTTACCATTCCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1172s1c1
Sequence:CCGGGAAAGGGTTACGCATGAAGATCTCGAGATCTTCATGCGTAACCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-708s1c1
Sequence:CCGGGTCAGGCTAAATCCAGATGATCTCGAGATCATCTGGATTTAGCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1406s1c1
Sequence:CCGGCCTTGGGCTTATCCACAAATTCTCGAGAATTTGTGGATAAGCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010987
IFIT1B MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1211s1c1
Sequence:CCGGGCAAGAGATTCATTACCACTACTCGAGTAGTGGTAATGAATCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010987.1-1739s1c1
Sequence:CCGGCCTGATGGAATGGTAAAGCAACTCGAGTTGCTTTACCATTCCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1172s1c1
Sequence:CCGGGAAAGGGTTACGCATGAAGATCTCGAGATCTTCATGCGTAACCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-708s1c1
Sequence:CCGGGTCAGGCTAAATCCAGATGATCTCGAGATCATCTGGATTTAGCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010987.1-1406s1c1
Sequence:CCGGCCTTGGGCTTATCCACAAATTCTCGAGAATTTGTGGATAAGCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)