EMAIL THIS PAGE TO A FRIEND

IFIT2

interferon-induced protein with tetratricopeptide repeats 2

66 Gene Product Result for
Synonyms: G10P2 GARG-39 IFI-54 IFI-54K IFI54 IFIT-2 ISG-54 K ISG-54K ISG54 P54 cig42
UniProtKB ID: P09913, Q5T767
Gene ID:
Mouse(15958) interferon-induced protein with tetratricopeptide repeats 2
Rat(294091) interferon-induced protein with tetratricopeptide repeats 2
Zebrafish(322336) interferon-induced protein with tetratricopeptide repeats 2
dog(479183) interferon-induced protein with tetratricopeptide repeats 2
domestic cat(101099150) interferon-induced protein with tetratricopeptide repeats 2
cow(527528) interferon-induced protein with tetratricopeptide repeats 2
naked mole-rat(101700834) interferon-induced protein with tetratricopeptide repeats 2
sheep(101101941) interferon-induced protein with tetratricopeptide repeats 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001547 Rosetta Predictions human pricing
NM_001024753 Rosetta Predictions rat pricing
NM_008332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156677 predicted 1305
2 SASI_Hs02_00332091 predicted 1255
3 SASI_Hs01_00156678 predicted 333
4 SASI_Hs01_00156679 predicted 344
5 SASI_Hs01_00156680 predicted 747
6 SASI_Hs01_00156681 predicted 790
7 SASI_Hs01_00156682 predicted 1450
8 SASI_Hs01_00156683 predicted 1669
9 SASI_Hs01_00156684 predicted 1140
10 SASI_Hs01_00156685 predicted 1098
11 SASI_Hs01_00156686 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114609 predicted 982
2 SASI_Rn01_00114610 predicted 500
3 SASI_Rn02_00202629 predicted 538
4 SASI_Rn01_00114611 predicted 1235
5 SASI_Rn01_00114612 predicted 821
6 SASI_Rn01_00114613 predicted 640
7 SASI_Rn01_00114614 predicted 364
8 SASI_Rn01_00114615 predicted 770
9 SASI_Rn01_00114616 predicted 1655
10 SASI_Rn01_00114617 predicted 1378
11 SASI_Rn01_00114618 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185866 predicted 1254
2 SASI_Mm01_00185867 predicted 1400
3 SASI_Mm01_00185868 predicted 1723
4 SASI_Mm01_00185869 predicted 1120
5 SASI_Mm01_00185870 predicted 1572
6 SASI_Mm01_00185871 predicted 1395
7 SASI_Mm01_00185872 predicted 765
8 SASI_Mm02_00313666 predicted 1356
9 SASI_Mm01_00185873 predicted 1179
10 SASI_Mm01_00185874 predicted 584
11 SASI_Mm01_00185865 predicted 838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001547
VALIDATED
IFIT2 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-239s1c1
Sequence:CCGGGCAACCTACTGGCCTATCTAACTCGAGTTAGATAGGCCAGTAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-790s21c1
Sequence:CCGGTCCTGACAACCAGTACCTTAACTCGAGTTAAGGTACTGGTTGTCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001547.3-1832s1c1
Sequence:CCGGGCAGCCAAATCCTTCATGTAACTCGAGTTACATGAAGGATTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-403s1c1
Sequence:CCGGCGACTCTCAGACGTTCAGATTCTCGAGAATCTGAACGTCTGAGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-1387s1c1
Sequence:CCGGGCATTCCTTCAGGAGCTGAATCTCGAGATTCAGCTCCTGAAGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1266s21c1
Sequence:CCGGAGCTTACTCCTGTAGCGAAACCTCGAGGTTTCGCTACAGGAGTAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001547.4-1879s21c1
Sequence:CCGGGTCACCTTTAGTGGAGTAATCCTCGAGGATTACTCCACTAAAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-957s21c1
Sequence:CCGGATGAGCCAGACAAAGCGATTGCTCGAGCAATCGCTTTGTCTGGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1342s21c1
Sequence:CCGGCAAGGCCATCCACCACTTTATCTCGAGATAAAGTGGTGGATGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001547.3-2074s1c1
Sequence:CCGGCCTGATTAATTGAGGTGGCAACTCGAGTTGCCACCTCAATTAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001547.3-694s1c1
Sequence:CCGGCCTGACAACCAGTACCTTAAACTCGAGTTTAAGGTACTGGTTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1221s21c1
Sequence:CCGGAGTATGAAGACGCAGAGTATTCTCGAGAATACTCTGCGTCTTCATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1296s21c1
Sequence:CCGGATCTGCGGTATGGCAACTTTCCTCGAGGAAAGTTGCCATACCGCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001547
VALIDATED
IFIT2 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-239s1c1
Sequence:CCGGGCAACCTACTGGCCTATCTAACTCGAGTTAGATAGGCCAGTAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-790s21c1
Sequence:CCGGTCCTGACAACCAGTACCTTAACTCGAGTTAAGGTACTGGTTGTCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001547.3-1832s1c1
Sequence:CCGGGCAGCCAAATCCTTCATGTAACTCGAGTTACATGAAGGATTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-403s1c1
Sequence:CCGGCGACTCTCAGACGTTCAGATTCTCGAGAATCTGAACGTCTGAGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-1387s1c1
Sequence:CCGGGCATTCCTTCAGGAGCTGAATCTCGAGATTCAGCTCCTGAAGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1266s21c1
Sequence:CCGGAGCTTACTCCTGTAGCGAAACCTCGAGGTTTCGCTACAGGAGTAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001547.4-1879s21c1
Sequence:CCGGGTCACCTTTAGTGGAGTAATCCTCGAGGATTACTCCACTAAAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-957s21c1
Sequence:CCGGATGAGCCAGACAAAGCGATTGCTCGAGCAATCGCTTTGTCTGGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1342s21c1
Sequence:CCGGCAAGGCCATCCACCACTTTATCTCGAGATAAAGTGGTGGATGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001547.3-2074s1c1
Sequence:CCGGCCTGATTAATTGAGGTGGCAACTCGAGTTGCCACCTCAATTAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001547.3-694s1c1
Sequence:CCGGCCTGACAACCAGTACCTTAAACTCGAGTTTAAGGTACTGGTTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1221s21c1
Sequence:CCGGAGTATGAAGACGCAGAGTATTCTCGAGAATACTCTGCGTCTTCATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1296s21c1
Sequence:CCGGATCTGCGGTATGGCAACTTTCCTCGAGGAAAGTTGCCATACCGCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001547
VALIDATED
IFIT2 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-239s1c1
Sequence:CCGGGCAACCTACTGGCCTATCTAACTCGAGTTAGATAGGCCAGTAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-790s21c1
Sequence:CCGGTCCTGACAACCAGTACCTTAACTCGAGTTAAGGTACTGGTTGTCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001547.3-1832s1c1
Sequence:CCGGGCAGCCAAATCCTTCATGTAACTCGAGTTACATGAAGGATTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-403s1c1
Sequence:CCGGCGACTCTCAGACGTTCAGATTCTCGAGAATCTGAACGTCTGAGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001547.3-1387s1c1
Sequence:CCGGGCATTCCTTCAGGAGCTGAATCTCGAGATTCAGCTCCTGAAGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1266s21c1
Sequence:CCGGAGCTTACTCCTGTAGCGAAACCTCGAGGTTTCGCTACAGGAGTAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001547.4-1879s21c1
Sequence:CCGGGTCACCTTTAGTGGAGTAATCCTCGAGGATTACTCCACTAAAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-957s21c1
Sequence:CCGGATGAGCCAGACAAAGCGATTGCTCGAGCAATCGCTTTGTCTGGCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1342s21c1
Sequence:CCGGCAAGGCCATCCACCACTTTATCTCGAGATAAAGTGGTGGATGGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001547.3-2074s1c1
Sequence:CCGGCCTGATTAATTGAGGTGGCAACTCGAGTTGCCACCTCAATTAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001547.3-694s1c1
Sequence:CCGGCCTGACAACCAGTACCTTAAACTCGAGTTTAAGGTACTGGTTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1221s21c1
Sequence:CCGGAGTATGAAGACGCAGAGTATTCTCGAGAATACTCTGCGTCTTCATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001547.4-1296s21c1
Sequence:CCGGATCTGCGGTATGGCAACTTTCCTCGAGGAAAGTTGCCATACCGCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008332
VALIDATED
IFIT2 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000077463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008332.2-2970s1c1
Sequence:CCGGGCTGATTTATACGCGATGATTCTCGAGAATCATCGCGTATAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008332.2-1269s1c1
Sequence:CCGGGCCGATTACTACTTCCAGAAACTCGAGTTTCTGGAAGTAGTAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008332.2-1506s1c1
Sequence:CCGGGCCTTGCATATCTTGGCATTTCTCGAGAAATGCCAAGATATGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008332
VALIDATED
IFIT2 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000077463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008332.2-2970s1c1
Sequence:CCGGGCTGATTTATACGCGATGATTCTCGAGAATCATCGCGTATAAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008332.2-1269s1c1
Sequence:CCGGGCCGATTACTACTTCCAGAAACTCGAGTTTCTGGAAGTAGTAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008332.2-1506s1c1
Sequence:CCGGGCCTTGCATATCTTGGCATTTCTCGAGAAATGCCAAGATATGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008332
VALIDATED
IFIT2 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000077463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008332.2-2970s1c1
Sequence:CCGGGCTGATTTATACGCGATGATTCTCGAGAATCATCGCGTATAAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008332.2-1269s1c1
Sequence:CCGGGCCGATTACTACTTCCAGAAACTCGAGTTTCTGGAAGTAGTAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008332.2-1506s1c1
Sequence:CCGGGCCTTGCATATCTTGGCATTTCTCGAGAAATGCCAAGATATGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)