EMAIL THIS PAGE TO A FRIEND

IFIT3

interferon-induced protein with tetratricopeptide repeats 3

55 Gene Product Result for
Synonyms: CIG-49 GARG-49 IFI60 IFIT4 IRG2 ISG60 P60 RIG-G
UniProtKB ID: O14879, Q99634, Q9BSK7
Gene ID:
Mouse(15959) interferon-induced protein with tetratricopeptide repeats 3
Rat(309526) interferon-induced protein with tetratricopeptide repeats 3
sheep(101121899) interferon-induced protein with tetratricopeptide repeats 3
domestic guinea pig(100728063) interferon-induced protein with tetratricopeptide repeats 3
naked mole-rat(101714328) interferon-induced protein with tetratricopeptide repeats 3
domestic cat(101099402) interferon-induced protein with tetratricopeptide repeats 3
Horse(100071605) interferon-induced protein with tetratricopeptide repeats 3
cow(509678) interferon-induced protein with tetratricopeptide repeats 3
dog(606808) interferon-induced protein with tetratricopeptide repeats 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031683 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031683 Rosetta Predictions human pricing
NM_001549 Rosetta Predictions human pricing
NM_001007694 Rosetta Predictions rat pricing
NM_010501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242810 predicted 886
2 SASI_Hs01_00242812 predicted 461
3 SASI_Hs02_00307688 predicted 937
4 SASI_Hs01_00242813 predicted 610
5 SASI_Hs01_00242814 predicted 667
6 SASI_Hs01_00242815 predicted 434
7 SASI_Hs01_00242816 predicted 477
8 SASI_Hs01_00242817 predicted 412
9 SASI_Hs01_00242818 predicted 1009
10 SASI_Hs01_00242819 predicted 1017
11 SASI_Hs01_00242811 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197446 predicted 884
2 SASI_Hs01_00197448 predicted 468
3 SASI_Hs02_00332099 predicted 938
4 SASI_Hs01_00197449 predicted 605
5 SASI_Hs01_00197450 predicted 673
6 SASI_Hs01_00197451 predicted 431
7 SASI_Hs01_00197452 predicted 475
8 SASI_Hs01_00197453 predicted 411
9 SASI_Hs01_00197454 predicted 1007
10 SASI_Hs01_00197455 predicted 1015
11 SASI_Hs01_00197447 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074698 predicted 195
2 SASI_Rn01_00074700 predicted 541
3 SASI_Rn01_00074701 predicted 951
4 SASI_Rn01_00074702 predicted 1218
5 SASI_Rn01_00074703 predicted 1236
6 SASI_Rn01_00074704 predicted 307
7 SASI_Rn01_00074705 predicted 1081
8 SASI_Rn01_00074706 predicted 567
9 SASI_Rn02_00198850 predicted 1070
10 SASI_Rn02_00198851 predicted 1161
11 SASI_Rn01_00074697 predicted 411
12 SASI_Rn01_00074699 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116015 predicted 1295
2 SASI_Mm01_00116016 predicted 1284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010501
VALIDATED
IFIT3 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-991s21c1
Sequence:CCGGTGGCAGAACTGAGACGATTAACTCGAGTTAATCGTCTCAGTTCTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010501.2-1293s21c1
Sequence:CCGGCTTAACCTCCAGTAGCAAATTCTCGAGAATTTGCTACTGGAGGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-323s21c1
Sequence:CCGGGCACAATGATCAATCAGAAATCTCGAGATTTCTGATTGATCATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-185s21c1
Sequence:CCGGGTGCAACCAGGTCGAACATTTCTCGAGAAATGTTCGACCTGGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-1148s21c1
Sequence:CCGGAGACCTCTATGAGCGCTATTGCTCGAGCAATAGCGCTCATAGAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010501.1-1537s1c1
Sequence:CCGGGCTGACAAACTGCTCTTGATTCTCGAGAATCAAGAGCAGTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-224s1c1
Sequence:CCGGGCCTACATAAAGCACCTAGATCTCGAGATCTAGGTGCTTTATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-352s1c1
Sequence:CCGGCGCCTGGATCTACTATCACATCTCGAGATGTGATAGTAGATCCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-1027s1c1
Sequence:CCGGGCGAAGTCCTTTGAACTCCTACTCGAGTAGGAGTTCAAAGGACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-662s1c1
Sequence:CCGGCCTCAGAACCAGTACCTGAAACTCGAGTTTCAGGTACTGGTTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010501
VALIDATED
IFIT3 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-991s21c1
Sequence:CCGGTGGCAGAACTGAGACGATTAACTCGAGTTAATCGTCTCAGTTCTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010501.2-1293s21c1
Sequence:CCGGCTTAACCTCCAGTAGCAAATTCTCGAGAATTTGCTACTGGAGGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-323s21c1
Sequence:CCGGGCACAATGATCAATCAGAAATCTCGAGATTTCTGATTGATCATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-185s21c1
Sequence:CCGGGTGCAACCAGGTCGAACATTTCTCGAGAAATGTTCGACCTGGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-1148s21c1
Sequence:CCGGAGACCTCTATGAGCGCTATTGCTCGAGCAATAGCGCTCATAGAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010501.1-1537s1c1
Sequence:CCGGGCTGACAAACTGCTCTTGATTCTCGAGAATCAAGAGCAGTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-224s1c1
Sequence:CCGGGCCTACATAAAGCACCTAGATCTCGAGATCTAGGTGCTTTATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-352s1c1
Sequence:CCGGCGCCTGGATCTACTATCACATCTCGAGATGTGATAGTAGATCCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-1027s1c1
Sequence:CCGGGCGAAGTCCTTTGAACTCCTACTCGAGTAGGAGTTCAAAGGACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-662s1c1
Sequence:CCGGCCTCAGAACCAGTACCTGAAACTCGAGTTTCAGGTACTGGTTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010501
VALIDATED
IFIT3 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-991s21c1
Sequence:CCGGTGGCAGAACTGAGACGATTAACTCGAGTTAATCGTCTCAGTTCTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010501.2-1293s21c1
Sequence:CCGGCTTAACCTCCAGTAGCAAATTCTCGAGAATTTGCTACTGGAGGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-323s21c1
Sequence:CCGGGCACAATGATCAATCAGAAATCTCGAGATTTCTGATTGATCATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-185s21c1
Sequence:CCGGGTGCAACCAGGTCGAACATTTCTCGAGAAATGTTCGACCTGGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010501.2-1148s21c1
Sequence:CCGGAGACCTCTATGAGCGCTATTGCTCGAGCAATAGCGCTCATAGAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010501.1-1537s1c1
Sequence:CCGGGCTGACAAACTGCTCTTGATTCTCGAGAATCAAGAGCAGTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-224s1c1
Sequence:CCGGGCCTACATAAAGCACCTAGATCTCGAGATCTAGGTGCTTTATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-352s1c1
Sequence:CCGGCGCCTGGATCTACTATCACATCTCGAGATGTGATAGTAGATCCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-1027s1c1
Sequence:CCGGGCGAAGTCCTTTGAACTCCTACTCGAGTAGGAGTTCAAAGGACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010501.1-662s1c1
Sequence:CCGGCCTCAGAACCAGTACCTGAAACTCGAGTTTCAGGTACTGGTTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031683
VALIDATED
IFIT3 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031683.2-1725s21c1
Sequence:CCGGATGTTGCTCTAAGGTACATTTCTCGAGAAATGTACCTTAGAGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-676s21c1
Sequence:CCGGGCGATGTACCATCTGGATAATCTCGAGATTATCCAGATGGTACATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-1489s21c1
Sequence:CCGGCCTTCAGGCATAGGCAGTATTCTCGAGAATACTGCCTATGCCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031683.1-1794s1c1
Sequence:CCGGCACAGTGAAATCCCGTCTCTACTCGAGTAGAGACGGGATTTCACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-612s1c1
Sequence:CCGGGCGATGTACCATCTGGATAATCTCGAGATTATCCAGATGGTACATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-1317s1c1
Sequence:CCGGGCACCAAATTATTGGTATCTTCTCGAGAAGATACCAATAATTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-1425s1c1
Sequence:CCGGCCTTCAGGCATAGGCAGTATTCTCGAGAATACTGCCTATGCCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-279s21c1
Sequence:CCGGCACTGAGTTCAAAGCTACAATCTCGAGATTGTAGCTTTGAACTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-1081s21c1
Sequence:CCGGGCTATGGACTATTCGAATAAACTCGAGTTTATTCGAATAGTCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-215s1c1
Sequence:CCGGCACTGAGTTCAAAGCTACAATCTCGAGATTGTAGCTTTGAACTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031683
VALIDATED
IFIT3 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031683.2-1725s21c1
Sequence:CCGGATGTTGCTCTAAGGTACATTTCTCGAGAAATGTACCTTAGAGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-676s21c1
Sequence:CCGGGCGATGTACCATCTGGATAATCTCGAGATTATCCAGATGGTACATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-1489s21c1
Sequence:CCGGCCTTCAGGCATAGGCAGTATTCTCGAGAATACTGCCTATGCCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031683.1-1794s1c1
Sequence:CCGGCACAGTGAAATCCCGTCTCTACTCGAGTAGAGACGGGATTTCACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-612s1c1
Sequence:CCGGGCGATGTACCATCTGGATAATCTCGAGATTATCCAGATGGTACATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-1317s1c1
Sequence:CCGGGCACCAAATTATTGGTATCTTCTCGAGAAGATACCAATAATTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-1425s1c1
Sequence:CCGGCCTTCAGGCATAGGCAGTATTCTCGAGAATACTGCCTATGCCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-279s21c1
Sequence:CCGGCACTGAGTTCAAAGCTACAATCTCGAGATTGTAGCTTTGAACTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-1081s21c1
Sequence:CCGGGCTATGGACTATTCGAATAAACTCGAGTTTATTCGAATAGTCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-215s1c1
Sequence:CCGGCACTGAGTTCAAAGCTACAATCTCGAGATTGTAGCTTTGAACTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031683
VALIDATED
IFIT3 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031683.2-1725s21c1
Sequence:CCGGATGTTGCTCTAAGGTACATTTCTCGAGAAATGTACCTTAGAGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-676s21c1
Sequence:CCGGGCGATGTACCATCTGGATAATCTCGAGATTATCCAGATGGTACATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-1489s21c1
Sequence:CCGGCCTTCAGGCATAGGCAGTATTCTCGAGAATACTGCCTATGCCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001031683.1-1794s1c1
Sequence:CCGGCACAGTGAAATCCCGTCTCTACTCGAGTAGAGACGGGATTTCACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-612s1c1
Sequence:CCGGGCGATGTACCATCTGGATAATCTCGAGATTATCCAGATGGTACATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-1317s1c1
Sequence:CCGGGCACCAAATTATTGGTATCTTCTCGAGAAGATACCAATAATTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-1425s1c1
Sequence:CCGGCCTTCAGGCATAGGCAGTATTCTCGAGAATACTGCCTATGCCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-279s21c1
Sequence:CCGGCACTGAGTTCAAAGCTACAATCTCGAGATTGTAGCTTTGAACTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031683.2-1081s21c1
Sequence:CCGGGCTATGGACTATTCGAATAAACTCGAGTTTATTCGAATAGTCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001031683.1-215s1c1
Sequence:CCGGCACTGAGTTCAAAGCTACAATCTCGAGATTGTAGCTTTGAACTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)