EMAIL THIS PAGE TO A FRIEND

IFIT5

interferon-induced protein with tetratricopeptide repeats 5

29 Gene Product Result for
Synonyms: P58 RI58
UniProtKB ID: Q13325, B2R5X9, Q5T7I9, Q6IAX3
Gene ID:
Zebrafish(567504) interferon-induced protein with tetratricopeptide repeats 5
cow(515091) interferon-induced protein with tetratricopeptide repeats 5
Horse(100071577) interferon-induced protein with tetratricopeptide repeats 5
dog(486788) interferon-induced protein with tetratricopeptide repeats 5
chicken(423790) interferon-induced protein with tetratricopeptide repeats 5
domestic guinea pig(100728626) interferon-induced protein with tetratricopeptide repeats 5
naked mole-rat(101715749) interferon-induced protein with tetratricopeptide repeats 5
sheep(101102441) interferon-induced protein with tetratricopeptide repeats 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044531 MISSION® esiRNA esiRNA human IFIT5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063906 predicted 1223
2 SASI_Hs01_00063907 predicted 1056
3 SASI_Hs01_00063908 predicted 555
4 SASI_Hs01_00063909 predicted 1066
5 SASI_Hs01_00063910 predicted 1378
6 SASI_Hs01_00063911 predicted 679
7 SASI_Hs01_00063912 predicted 488
8 SASI_Hs02_00344284 predicted 475
9 SASI_Hs02_00344285 predicted 875
10 SASI_Hs01_00063914 predicted 451
11 SASI_Hs01_00063913 predicted 1120
12 SASI_Hs01_00063915 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012420
VALIDATED
IFIT5 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein with tetratricopeptide repeats 5
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1420s1c1
Sequence:CCGGGTGCAGAGTTTAAGTGCCCTACTCGAGTAGGGCACTTAAACTCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012420.1-637s1c1
Sequence:CCGGCCAGAATTTAACATCGGCTATCTCGAGATAGCCGATGTTAAATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012420.1-3652s1c1
Sequence:CCGGCCCATAGAGAATGACTTAATTCTCGAGAATTAAGTCATTCTCTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-346s1c1
Sequence:CCGGGCAGAAGAAATAATCCAGCAACTCGAGTTGCTGGATTATTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1069s1c1
Sequence:CCGGGAGCTGATTTCATCTGCTATACTCGAGTATAGCAGATGAAATCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-747s1c1
Sequence:CCGGGAACCCAGATAACAGCTATATCTCGAGATATAGCTGTTATCTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-1308s1c1
Sequence:CCGGCCATCATTATTTAGAAGCCTTCTCGAGAAGGCTTCTAAATAATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1216s1c1
Sequence:CCGGCTGGAGAACATAACCGATGATCTCGAGATCATCGGTTATGTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012420.2-2073s21c1
Sequence:CCGGTGATAGTTAAGCTCTTAATTGCTCGAGCAATTAAGAGCTTAACTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1422s21c1
Sequence:CCGGCCATCATTATTTAGAAGCCTTCTCGAGAAGGCTTCTAAATAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012420.2-974s21c1
Sequence:CCGGAGCCTTACGTCCTTCGTTATGCTCGAGCATAACGAAGGACGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-460s21c1
Sequence:CCGGGCAGAAGAAATAATCCAGCAACTCGAGTTGCTGGATTATTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012420.2-2135s21c1
Sequence:CCGGTGACTTTGATGAGGATATTTACTCGAGTAAATATCCTCATCAAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1186s21c1
Sequence:CCGGCTGATTTCATCTGCTATATTTCTCGAGAAATATAGCAGATGAAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1385s21c1
Sequence:CCGGTTCAGGAATTTCACCGTAAATCTCGAGATTTACGGTGAAATTCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-861s21c1
Sequence:CCGGGAACCCAGATAACAGCTATATCTCGAGATATAGCTGTTATCTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012420
VALIDATED
IFIT5 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein with tetratricopeptide repeats 5
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1420s1c1
Sequence:CCGGGTGCAGAGTTTAAGTGCCCTACTCGAGTAGGGCACTTAAACTCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012420.1-637s1c1
Sequence:CCGGCCAGAATTTAACATCGGCTATCTCGAGATAGCCGATGTTAAATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012420.1-3652s1c1
Sequence:CCGGCCCATAGAGAATGACTTAATTCTCGAGAATTAAGTCATTCTCTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-346s1c1
Sequence:CCGGGCAGAAGAAATAATCCAGCAACTCGAGTTGCTGGATTATTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1069s1c1
Sequence:CCGGGAGCTGATTTCATCTGCTATACTCGAGTATAGCAGATGAAATCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-747s1c1
Sequence:CCGGGAACCCAGATAACAGCTATATCTCGAGATATAGCTGTTATCTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-1308s1c1
Sequence:CCGGCCATCATTATTTAGAAGCCTTCTCGAGAAGGCTTCTAAATAATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1216s1c1
Sequence:CCGGCTGGAGAACATAACCGATGATCTCGAGATCATCGGTTATGTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012420.2-2073s21c1
Sequence:CCGGTGATAGTTAAGCTCTTAATTGCTCGAGCAATTAAGAGCTTAACTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1422s21c1
Sequence:CCGGCCATCATTATTTAGAAGCCTTCTCGAGAAGGCTTCTAAATAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012420.2-974s21c1
Sequence:CCGGAGCCTTACGTCCTTCGTTATGCTCGAGCATAACGAAGGACGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-460s21c1
Sequence:CCGGGCAGAAGAAATAATCCAGCAACTCGAGTTGCTGGATTATTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012420.2-2135s21c1
Sequence:CCGGTGACTTTGATGAGGATATTTACTCGAGTAAATATCCTCATCAAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1186s21c1
Sequence:CCGGCTGATTTCATCTGCTATATTTCTCGAGAAATATAGCAGATGAAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1385s21c1
Sequence:CCGGTTCAGGAATTTCACCGTAAATCTCGAGATTTACGGTGAAATTCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-861s21c1
Sequence:CCGGGAACCCAGATAACAGCTATATCTCGAGATATAGCTGTTATCTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012420
VALIDATED
IFIT5 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein with tetratricopeptide repeats 5
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1420s1c1
Sequence:CCGGGTGCAGAGTTTAAGTGCCCTACTCGAGTAGGGCACTTAAACTCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012420.1-637s1c1
Sequence:CCGGCCAGAATTTAACATCGGCTATCTCGAGATAGCCGATGTTAAATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012420.1-3652s1c1
Sequence:CCGGCCCATAGAGAATGACTTAATTCTCGAGAATTAAGTCATTCTCTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-346s1c1
Sequence:CCGGGCAGAAGAAATAATCCAGCAACTCGAGTTGCTGGATTATTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1069s1c1
Sequence:CCGGGAGCTGATTTCATCTGCTATACTCGAGTATAGCAGATGAAATCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-747s1c1
Sequence:CCGGGAACCCAGATAACAGCTATATCTCGAGATATAGCTGTTATCTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012420.1-1308s1c1
Sequence:CCGGCCATCATTATTTAGAAGCCTTCTCGAGAAGGCTTCTAAATAATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012420.1-1216s1c1
Sequence:CCGGCTGGAGAACATAACCGATGATCTCGAGATCATCGGTTATGTTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012420.2-2073s21c1
Sequence:CCGGTGATAGTTAAGCTCTTAATTGCTCGAGCAATTAAGAGCTTAACTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1422s21c1
Sequence:CCGGCCATCATTATTTAGAAGCCTTCTCGAGAAGGCTTCTAAATAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012420.2-974s21c1
Sequence:CCGGAGCCTTACGTCCTTCGTTATGCTCGAGCATAACGAAGGACGTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-460s21c1
Sequence:CCGGGCAGAAGAAATAATCCAGCAACTCGAGTTGCTGGATTATTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012420.2-2135s21c1
Sequence:CCGGTGACTTTGATGAGGATATTTACTCGAGTAAATATCCTCATCAAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1186s21c1
Sequence:CCGGCTGATTTCATCTGCTATATTTCTCGAGAAATATAGCAGATGAAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-1385s21c1
Sequence:CCGGTTCAGGAATTTCACCGTAAATCTCGAGATTTACGGTGAAATTCCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012420.2-861s21c1
Sequence:CCGGGAACCCAGATAACAGCTATATCTCGAGATATAGCTGTTATCTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)