EMAIL THIS PAGE TO A FRIEND

IFITM10

interferon induced transmembrane protein 10

14 Gene Product Result for
Synonyms: DSPA3
UniProtKB ID: A6NMD0, A6NEU7
Gene ID:
Mouse(320802) interferon induced transmembrane protein 10
naked mole-rat(101708666) interferon induced transmembrane protein 10
chicken(771148) interferon induced transmembrane protein 10
domestic cat(101094879) interferon induced transmembrane protein 10
dog(611537) interferon induced transmembrane protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162945 predicted 560
2 SASI_Mm01_00162946 predicted 817
3 SASI_Mm01_00162947 predicted 550
4 SASI_Mm01_00162948 predicted 875
5 SASI_Mm01_00162949 predicted 962
6 SASI_Mm01_00162950 predicted 343
7 SASI_Mm01_00162951 predicted 314
8 SASI_Mm01_00162952 predicted 516
9 SASI_Mm01_00162953 predicted 656
10 SASI_Mm01_00162954 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177265
IFITM10 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 10
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-561s1c1
Sequence:CCGGGACTAATACGAATAGAGGAAACTCGAGTTTCCTCTATTCGTATTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-563s1c1
Sequence:CCGGCTAATACGAATAGAGGAAAGACTCGAGTCTTTCCTCTATTCGTATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-554s1c1
Sequence:CCGGGAACTCTGACTAATACGAATACTCGAGTATTCGTATTAGTCAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-492s1c1
Sequence:CCGGCAACTTCGTCTACCTCAACTTCTCGAGAAGTTGAGGTAGACGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177265
IFITM10 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 10
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-561s1c1
Sequence:CCGGGACTAATACGAATAGAGGAAACTCGAGTTTCCTCTATTCGTATTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-563s1c1
Sequence:CCGGCTAATACGAATAGAGGAAAGACTCGAGTCTTTCCTCTATTCGTATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-554s1c1
Sequence:CCGGGAACTCTGACTAATACGAATACTCGAGTATTCGTATTAGTCAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-492s1c1
Sequence:CCGGCAACTTCGTCTACCTCAACTTCTCGAGAAGTTGAGGTAGACGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177265
IFITM10 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 10
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-561s1c1
Sequence:CCGGGACTAATACGAATAGAGGAAACTCGAGTTTCCTCTATTCGTATTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-563s1c1
Sequence:CCGGCTAATACGAATAGAGGAAAGACTCGAGTCTTTCCTCTATTCGTATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-554s1c1
Sequence:CCGGGAACTCTGACTAATACGAATACTCGAGTATTCGTATTAGTCAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177265.2-492s1c1
Sequence:CCGGCAACTTCGTCTACCTCAACTTCTCGAGAAGTTGAGGTAGACGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)