EMAIL THIS PAGE TO A FRIEND

IFITM1

interferon induced transmembrane protein 1

63 Gene Product Result for
Synonyms: 9-27 CD225 DSPA2a IFI17 LEU13
UniProtKB ID: P13164, Q15322, Q53XZ0
Gene ID:
Mouse(68713) interferon induced transmembrane protein 1
Rat(293618) interferon induced transmembrane protein 1
domestic cat(101086846) interferon induced transmembrane protein 1
cow(353510) interferon induced transmembrane protein 1 (9-27)
dog(483397) interferon induced transmembrane protein 1 (9-27)
sheep(101105867) interferon induced transmembrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003641 Rosetta Predictions human pricing
NM_001106314 Rosetta Predictions rat pricing
NM_001112715 Rosetta Predictions mouse pricing
NM_026820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336000 predicted 478
2 SASI_Hs02_00336001 predicted 470
3 SASI_Hs01_00094468 predicted 488
4 SASI_Hs01_00094470 predicted 303
5 SASI_Hs01_00094471 predicted 236
6 SASI_Hs01_00094473 predicted 224
7 SASI_Hs01_00094474 predicted 506
8 SASI_Hs01_00094475 predicted 497
9 SASI_Hs01_00094476 predicted 577
10 SASI_Hs01_00094477 predicted 674
11 SASI_Hs01_00094469 predicted 617
12 SASI_Hs01_00094472 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217758 predicted 214
2 SASI_Rn02_00217759 predicted 311
3 SASI_Rn02_00217760 predicted 214
4 SASI_Rn02_00217761 predicted 446
5 SASI_Rn02_00217762 predicted 439
6 SASI_Rn02_00217763 predicted 317
7 SASI_Rn02_00217764 predicted 206
8 SASI_Rn02_00217765 predicted 449
9 SASI_Rn02_00217766 predicted 245
10 SASI_Rn02_00217767 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306993 predicted 411
2 SASI_Mm02_00306994 predicted 479
3 SASI_Mm02_00306995 predicted 457
4 SASI_Mm02_00306996 predicted 474
5 SASI_Mm02_00306997 predicted 430
6 SASI_Mm02_00306998 predicted 474
7 SASI_Mm02_00306999 predicted 436
8 SASI_Mm02_00307000 predicted 409
9 SASI_Mm02_00307001 predicted 460
10 SASI_Mm02_00307002 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166188 predicted 450
2 SASI_Mm02_00330975 predicted 442
3 SASI_Mm01_00166193 predicted 450
4 SASI_Mm02_00330976 predicted 451
5 SASI_Mm01_00166184 predicted 458
6 SASI_Mm01_00166185 predicted 632
7 SASI_Mm01_00166186 predicted 390
8 SASI_Mm01_00166187 predicted 638
9 SASI_Mm01_00166189 predicted 703
10 SASI_Mm01_00166190 predicted 677
11 SASI_Mm01_00166191 predicted 686
12 SASI_Mm01_00166192 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003641
VALIDATED
IFITM1 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-486s21c1
Sequence:CCGGGTTACTGGTATTCGGCTCTGTCTCGAGACAGAGCCGAATACCAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-522s21c1
Sequence:CCGGTATGTTACAGATAATACAGGACTCGAGTCCTGTATTATCTGTAACATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-239s21c1
Sequence:CCGGCAAGGTCCACCGTGATCAACACTCGAGTGTTGATCACGGTGGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003641.2-451s1c1
Sequence:CCGGCTTCTTGAACTGGTGCTGTCTCTCGAGAGACAGCACCAGTTCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-598s1c1
Sequence:CCGGCCTCATGACCATTGGATTCATCTCGAGATGAATCCAATGGTCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-636s1c1
Sequence:CCGGGCTCTGTGACAGTCTACCATACTCGAGTATGGTAGACTGTCACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-436s1c1
Sequence:CCGGCCTGTTCAACACCCTCTTCTTCTCGAGAAGAAGAGGGTGTTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003641
VALIDATED
IFITM1 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-486s21c1
Sequence:CCGGGTTACTGGTATTCGGCTCTGTCTCGAGACAGAGCCGAATACCAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-522s21c1
Sequence:CCGGTATGTTACAGATAATACAGGACTCGAGTCCTGTATTATCTGTAACATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-239s21c1
Sequence:CCGGCAAGGTCCACCGTGATCAACACTCGAGTGTTGATCACGGTGGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003641.2-451s1c1
Sequence:CCGGCTTCTTGAACTGGTGCTGTCTCTCGAGAGACAGCACCAGTTCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-598s1c1
Sequence:CCGGCCTCATGACCATTGGATTCATCTCGAGATGAATCCAATGGTCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-636s1c1
Sequence:CCGGGCTCTGTGACAGTCTACCATACTCGAGTATGGTAGACTGTCACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-436s1c1
Sequence:CCGGCCTGTTCAACACCCTCTTCTTCTCGAGAAGAAGAGGGTGTTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003641
VALIDATED
IFITM1 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-486s21c1
Sequence:CCGGGTTACTGGTATTCGGCTCTGTCTCGAGACAGAGCCGAATACCAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-522s21c1
Sequence:CCGGTATGTTACAGATAATACAGGACTCGAGTCCTGTATTATCTGTAACATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003641.3-239s21c1
Sequence:CCGGCAAGGTCCACCGTGATCAACACTCGAGTGTTGATCACGGTGGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003641.2-451s1c1
Sequence:CCGGCTTCTTGAACTGGTGCTGTCTCTCGAGAGACAGCACCAGTTCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-598s1c1
Sequence:CCGGCCTCATGACCATTGGATTCATCTCGAGATGAATCCAATGGTCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-636s1c1
Sequence:CCGGGCTCTGTGACAGTCTACCATACTCGAGTATGGTAGACTGTCACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003641.2-436s1c1
Sequence:CCGGCCTGTTCAACACCCTCTTCTTCTCGAGAAGAAGAGGGTGTTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026820
IFITM1 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-439s1c1
Sequence:CCGGCACAATCAACATGCCTGAGATCTCGAGATCTCAGGCATGTTGATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-665s1c1
Sequence:CCGGGTCATCGTTGTCTGTGCCATTCTCGAGAATGGCACAGACAACGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-487s1c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-547s1c1
Sequence:CCGGCGTGAAGTCTAGGGACAGGAACTCGAGTTCCTGTCCCTAGACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-619s1c1
Sequence:CCGGCCTGAACATCAGCTCCCTGTTCTCGAGAACAGGGAGCTGATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026820
IFITM1 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-439s1c1
Sequence:CCGGCACAATCAACATGCCTGAGATCTCGAGATCTCAGGCATGTTGATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-665s1c1
Sequence:CCGGGTCATCGTTGTCTGTGCCATTCTCGAGAATGGCACAGACAACGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-487s1c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-547s1c1
Sequence:CCGGCGTGAAGTCTAGGGACAGGAACTCGAGTTCCTGTCCCTAGACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-619s1c1
Sequence:CCGGCCTGAACATCAGCTCCCTGTTCTCGAGAACAGGGAGCTGATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026820
IFITM1 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-439s1c1
Sequence:CCGGCACAATCAACATGCCTGAGATCTCGAGATCTCAGGCATGTTGATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-665s1c1
Sequence:CCGGGTCATCGTTGTCTGTGCCATTCTCGAGAATGGCACAGACAACGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-487s1c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-547s1c1
Sequence:CCGGCGTGAAGTCTAGGGACAGGAACTCGAGTTCCTGTCCCTAGACTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026820.2-619s1c1
Sequence:CCGGCCTGAACATCAGCTCCCTGTTCTCGAGAACAGGGAGCTGATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)