EMAIL THIS PAGE TO A FRIEND

IFITM3

interferon induced transmembrane protein 3

56 Gene Product Result for
Synonyms: 1-8U DSPA2b IP15
UniProtKB ID: Q01628, Q53Y76, Q96HK8, Q96J15
Gene ID:
Human(10410) Summary: The protein encoded by this gene is an interferon-induced membrane protein that helps confer immunity to influenza A H1N1 virus, West Nile virus, and dengue virus. Two transcript variants, only one of them protein-coding, have been found for this gene. Another variant encoding an N-terminally truncated isoform has been reported, but the full-length nature of this variant has not been determined. [provided by RefSeq, May 2012]
Mouse(66141) interferon induced transmembrane protein 3
Rat(361673) interferon induced transmembrane protein 3
domestic guinea pig(100713319) interferon induced transmembrane protein 3
dog(606890) interferon induced transmembrane protein 3
domestic cat(101100838) interferon induced transmembrane protein 3
cow(282255) interferon induced transmembrane protein 3 (1-8U)
cow(777594) interferon induced transmembrane protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021034 Rosetta Predictions human pricing
XM_001059289 Rosetta Predictions rat pricing
XM_341957 Rosetta Predictions rat pricing
NM_025378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354510 predicted 105
2 SASI_Hs01_00038803 predicted 472
3 SASI_Hs01_00038804 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292707 predicted 196
2 SASI_Rn02_00292708 predicted 392
3 SASI_Rn02_00292709 predicted 215
4 SASI_Rn02_00292710 predicted 347
5 SASI_Rn02_00292711 predicted 208
6 SASI_Rn02_00292712 predicted 213
7 SASI_Rn02_00292713 predicted 440
8 SASI_Rn02_00292714 predicted 463
9 SASI_Rn02_00292715 predicted 105
10 SASI_Rn02_00292716 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152734 predicted 386
2 SASI_Rn02_00393609 predicted 415
3 SASI_Rn02_00393610 predicted 421
4 SASI_Rn01_00152736 predicted 352
5 SASI_Rn02_00393611 predicted 422
6 SASI_Rn01_00152741 predicted 438
7 SASI_Rn02_00393612 predicted 433
8 SASI_Rn01_00152742 predicted 464
9 SASI_Rn02_00393613 predicted 104
10 SASI_Rn01_00152735 predicted 218
11 SASI_Rn01_00152733 predicted 204
12 SASI_Rn01_00152737 predicted 356
13 SASI_Rn01_00152738 predicted 360
14 SASI_Rn01_00152739 predicted 360
15 SASI_Rn01_00152740 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156543 predicted 201
2 SASI_Mm01_00156544 predicted 421
3 SASI_Mm01_00156545 predicted 422
4 SASI_Mm01_00156550 predicted 209
5 SASI_Mm01_00156551 predicted 215
6 SASI_Mm01_00156547 predicted 401
7 SASI_Mm01_00156548 predicted 214
8 SASI_Mm01_00156549 predicted 408
9 SASI_Mm01_00156546 predicted 420
10 SASI_Mm01_00156552 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021034
IFITM3 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-611s1c1
Sequence:CCGGCAGTGCTGATCTTCCAGGCCTCTCGAGAGGCCTGGAAGATCAGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-458s1c1
Sequence:CCGGGCTTCATAGCATTCGCCTACTCTCGAGAGTAGGCGAATGCTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-552s1c1
Sequence:CCGGCCTGAACATCTGGGCCCTGATCTCGAGATCAGGGCCCAGATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-420s1c1
Sequence:CCGGCCTGTTCAACACCCTCTTCATCTCGAGATGAAGAGGGTGTTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021034.2-345s21c1
Sequence:CCGGGTGAAGTCTAGGGACAGGAAGCTCGAGCTTCCTGTCCCTAGACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-582s1c1
Sequence:CCGGCCTCATGACCATTCTGCTCATCTCGAGATGAGCAGAATGGTCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021034.2-154s21c1
Sequence:CCGGCCAACTATGAGATGCTCAAGGCTCGAGCCTTGAGCATCTCATAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021034
IFITM3 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-611s1c1
Sequence:CCGGCAGTGCTGATCTTCCAGGCCTCTCGAGAGGCCTGGAAGATCAGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-458s1c1
Sequence:CCGGGCTTCATAGCATTCGCCTACTCTCGAGAGTAGGCGAATGCTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-552s1c1
Sequence:CCGGCCTGAACATCTGGGCCCTGATCTCGAGATCAGGGCCCAGATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-420s1c1
Sequence:CCGGCCTGTTCAACACCCTCTTCATCTCGAGATGAAGAGGGTGTTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021034.2-345s21c1
Sequence:CCGGGTGAAGTCTAGGGACAGGAAGCTCGAGCTTCCTGTCCCTAGACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-582s1c1
Sequence:CCGGCCTCATGACCATTCTGCTCATCTCGAGATGAGCAGAATGGTCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021034.2-154s21c1
Sequence:CCGGCCAACTATGAGATGCTCAAGGCTCGAGCCTTGAGCATCTCATAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021034
IFITM3 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-611s1c1
Sequence:CCGGCAGTGCTGATCTTCCAGGCCTCTCGAGAGGCCTGGAAGATCAGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-458s1c1
Sequence:CCGGGCTTCATAGCATTCGCCTACTCTCGAGAGTAGGCGAATGCTATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-552s1c1
Sequence:CCGGCCTGAACATCTGGGCCCTGATCTCGAGATCAGGGCCCAGATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-420s1c1
Sequence:CCGGCCTGTTCAACACCCTCTTCATCTCGAGATGAAGAGGGTGTTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021034.2-345s21c1
Sequence:CCGGGTGAAGTCTAGGGACAGGAAGCTCGAGCTTCCTGTCCCTAGACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021034.1-582s1c1
Sequence:CCGGCCTCATGACCATTCTGCTCATCTCGAGATGAGCAGAATGGTCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021034.2-154s21c1
Sequence:CCGGCCAACTATGAGATGCTCAAGGCTCGAGCCTTGAGCATCTCATAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025378
VALIDATED
IFITM3 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-460s1c1
Sequence:CCGGCACCATTGTTAGTGTCATCATCTCGAGATGATGACACTAACAATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-459s21c1
Sequence:CCGGCACCATTGTTAGTGTCATCATCTCGAGATGATGACACTAACAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-436s21c1
Sequence:CCGGCTCAGCATCCTGATGGTTGTTCTCGAGAACAACCATCAGGATGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-222s21c1
Sequence:CCGGCAGAACTACTGTGATCAACATCTCGAGATGTTGATCACAGTAGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025378.1-160s1c1
Sequence:CCGGCGAAAGAATCAAGGAAGAATACTCGAGTATTCTTCCTTGATTCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-283s1c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-152s1c1
Sequence:CCGGCCAAACTACGAAAGAATCAAGCTCGAGCTTGATTCTTTCGTAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-282s21c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-155s21c1
Sequence:CCGGACTACGAAAGAATCAAGGAAGCTCGAGCTTCCTTGATTCTTTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025378
VALIDATED
IFITM3 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-460s1c1
Sequence:CCGGCACCATTGTTAGTGTCATCATCTCGAGATGATGACACTAACAATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-459s21c1
Sequence:CCGGCACCATTGTTAGTGTCATCATCTCGAGATGATGACACTAACAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-436s21c1
Sequence:CCGGCTCAGCATCCTGATGGTTGTTCTCGAGAACAACCATCAGGATGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-222s21c1
Sequence:CCGGCAGAACTACTGTGATCAACATCTCGAGATGTTGATCACAGTAGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025378.1-160s1c1
Sequence:CCGGCGAAAGAATCAAGGAAGAATACTCGAGTATTCTTCCTTGATTCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-283s1c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-152s1c1
Sequence:CCGGCCAAACTACGAAAGAATCAAGCTCGAGCTTGATTCTTTCGTAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-282s21c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-155s21c1
Sequence:CCGGACTACGAAAGAATCAAGGAAGCTCGAGCTTCCTTGATTCTTTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025378
VALIDATED
IFITM3 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-460s1c1
Sequence:CCGGCACCATTGTTAGTGTCATCATCTCGAGATGATGACACTAACAATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-459s21c1
Sequence:CCGGCACCATTGTTAGTGTCATCATCTCGAGATGATGACACTAACAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-436s21c1
Sequence:CCGGCTCAGCATCCTGATGGTTGTTCTCGAGAACAACCATCAGGATGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-222s21c1
Sequence:CCGGCAGAACTACTGTGATCAACATCTCGAGATGTTGATCACAGTAGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025378.1-160s1c1
Sequence:CCGGCGAAAGAATCAAGGAAGAATACTCGAGTATTCTTCCTTGATTCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-283s1c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025378.1-152s1c1
Sequence:CCGGCCAAACTACGAAAGAATCAAGCTCGAGCTTGATTCTTTCGTAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-282s21c1
Sequence:CCGGCCTGTTCAATACACTCTTCATCTCGAGATGAAGAGTGTATTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025378.2-155s21c1
Sequence:CCGGACTACGAAAGAATCAAGGAAGCTCGAGCTTCCTTGATTCTTTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)