EMAIL THIS PAGE TO A FRIEND

IFITM5

interferon induced transmembrane protein 5

45 Gene Product Result for
Synonyms: BRIL DSPA1 Hrmp1 OI5 fragilis4
UniProtKB ID: A6NNB3
Gene ID:
Human(387733) Summary: This gene encodes a membrane protein thought to play a role in bone mineralization. This gene is located on chromosome 11 in a cluster of related genes which are induced by interferon, however, this gene has not been shown to be interferon inducible. A similar gene, located in a gene cluster on mouse chromosome 7, is a member of the interferon-inducible fragilis gene family. The mouse gene encodes a transmembrane protein described as participating in germ cell competence. A mutation in the 5' UTR of this gene has been associated with osteogenesis imperfecta type V (PMID: 22863190, 22863195). [provided by RefSeq, Aug 2012]
Mouse(73835) interferon induced transmembrane protein 5
Rat(293617) interferon induced transmembrane protein 5
Zebrafish(100005237) interferon induced transmembrane protein 5
cow(526461) interferon induced transmembrane protein 5
domestic cat(101101083) interferon induced transmembrane protein 5
chicken(422992) interferon induced transmembrane protein 5
domestic guinea pig(100719456) interferon induced transmembrane protein 5
naked mole-rat(101723478) interferon induced transmembrane protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009791 MISSION® esiRNA esiRNA targeting mouse Ifitm5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025295 Rosetta Predictions human pricing
XM_215126 Rosetta Predictions rat pricing
NM_053088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220802 predicted 206
2 SASI_Hs01_00220803 predicted 268
3 SASI_Hs01_00220804 predicted 212
4 SASI_Hs01_00220805 predicted 408
5 SASI_Hs01_00220806 predicted 431
6 SASI_Hs01_00220807 predicted 229
7 SASI_Hs01_00220808 predicted 415
8 SASI_Hs01_00220809 predicted 200
9 SASI_Hs02_00307436 predicted 263
10 SASI_Hs01_00220811 predicted 198
11 SASI_Hs01_00220810 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184947 predicted 250
2 SASI_Rn01_00184948 predicted 364
3 SASI_Rn01_00184949 predicted 405
4 SASI_Rn01_00184950 predicted 389
5 SASI_Rn01_00184951 predicted 363
6 SASI_Rn01_00184952 predicted 395
7 SASI_Rn01_00184953 predicted 416
8 SASI_Rn01_00184954 predicted 377
9 SASI_Rn01_00184955 predicted 338
10 SASI_Rn01_00184956 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147863 predicted 379
2 SASI_Mm02_00337578 predicted 374
3 SASI_Mm01_00147864 predicted 357
4 SASI_Mm01_00147857 predicted 205
5 SASI_Mm01_00147865 predicted 357
6 SASI_Mm02_00337579 predicted 408
7 SASI_Mm02_00337580 predicted 430
8 SASI_Mm02_00337581 predicted 385
9 SASI_Mm02_00337582 predicted 363
10 SASI_Mm02_00337583 predicted 374
11 SASI_Mm01_00147856 predicted 227
12 SASI_Mm01_00147858 predicted 218
13 SASI_Mm01_00147859 predicted 231
14 SASI_Mm01_00147860 predicted 208
15 SASI_Mm01_00147861 predicted 205
16 SASI_Mm01_00147862 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025295
IFITM5 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-418s21c1
Sequence:CCGGGACGCGGACTATGACTGACAGCTCGAGCTGTCAGTCATAGTCCGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-161s21c1
Sequence:CCGGTCAGCACCCTCTACCTGAATCCTCGAGGATTCAGGTAGAGGGTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-276s1c1
Sequence:CCGGCAAAGCCAAGTGCTACAACATCTCGAGATGTTGTAGCACTTGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-399s1c1
Sequence:CCGGCTTCAGCACCAAGTTTGATGACTCGAGTCATCAAACTTGGTGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-396s1c1
Sequence:CCGGCTTCTTCAGCACCAAGTTTGACTCGAGTCAAACTTGGTGCTGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-171s1c1
Sequence:CCGGCTACCTGAATCTGTGTTGCCTCTCGAGAGGCAACACAGATTCAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-216s21c1
Sequence:CCGGCATCAAGGCCCGAGATCAGAACTCGAGTTCTGATCTCGGGCCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-410s21c1
Sequence:CCGGAGTTTGATGACGCGGACTATGCTCGAGCATAGTCCGCGTCATCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025295
IFITM5 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-418s21c1
Sequence:CCGGGACGCGGACTATGACTGACAGCTCGAGCTGTCAGTCATAGTCCGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-161s21c1
Sequence:CCGGTCAGCACCCTCTACCTGAATCCTCGAGGATTCAGGTAGAGGGTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-276s1c1
Sequence:CCGGCAAAGCCAAGTGCTACAACATCTCGAGATGTTGTAGCACTTGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-399s1c1
Sequence:CCGGCTTCAGCACCAAGTTTGATGACTCGAGTCATCAAACTTGGTGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-396s1c1
Sequence:CCGGCTTCTTCAGCACCAAGTTTGACTCGAGTCAAACTTGGTGCTGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-171s1c1
Sequence:CCGGCTACCTGAATCTGTGTTGCCTCTCGAGAGGCAACACAGATTCAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-216s21c1
Sequence:CCGGCATCAAGGCCCGAGATCAGAACTCGAGTTCTGATCTCGGGCCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-410s21c1
Sequence:CCGGAGTTTGATGACGCGGACTATGCTCGAGCATAGTCCGCGTCATCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025295
IFITM5 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-418s21c1
Sequence:CCGGGACGCGGACTATGACTGACAGCTCGAGCTGTCAGTCATAGTCCGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-161s21c1
Sequence:CCGGTCAGCACCCTCTACCTGAATCCTCGAGGATTCAGGTAGAGGGTGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-276s1c1
Sequence:CCGGCAAAGCCAAGTGCTACAACATCTCGAGATGTTGTAGCACTTGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-399s1c1
Sequence:CCGGCTTCAGCACCAAGTTTGATGACTCGAGTCATCAAACTTGGTGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-396s1c1
Sequence:CCGGCTTCTTCAGCACCAAGTTTGACTCGAGTCAAACTTGGTGCTGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025295.1-171s1c1
Sequence:CCGGCTACCTGAATCTGTGTTGCCTCTCGAGAGGCAACACAGATTCAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-216s21c1
Sequence:CCGGCATCAAGGCCCGAGATCAGAACTCGAGTTCTGATCTCGGGCCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025295.1-410s21c1
Sequence:CCGGAGTTTGATGACGCGGACTATGCTCGAGCATAGTCCGCGTCATCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053088
IFITM5 MISSION shRNA Bacterial Glycerol Stock
interferon induced transmembrane protein 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.1-167s1c1
Sequence:CCGGCGATGTACCTGAATCTGTGCTCTCGAGAGCACAGATTCAGGTACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.2-411s1c1
Sequence:CCGGGTTTGATGAGGAGGACTATAACTCGAGTTATAGTCCTCCTCATCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053088.2-503s21c1
Sequence:CCGGGGGAGTTACAGCCTACTATAGCTCGAGCTATAGTAGGCTGTAACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-126s21c1
Sequence:CCGGCCCTACACCACGAGATCACATCTCGAGATGTGATCTCGTGGTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-411s21c1
Sequence:CCGGGTTTGATGAGGAGGACTATAACTCGAGTTATAGTCCTCCTCATCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-359s21c1
Sequence:CCGGCCTTGCACCTGTCCAAGTTAGCTCGAGCTAACTTGGACAGGTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.1-177s1c1
Sequence:CCGGGAATCTGTGCTGCCTTGGATTCTCGAGAATCCAAGGCAGCACAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-161s21c1
Sequence:CCGGTCAGCACGATGTACCTGAATCCTCGAGGATTCAGGTACATCGTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053088
IFITM5 MISSION shRNA shRNA Plasmid DNA
interferon induced transmembrane protein 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.1-167s1c1
Sequence:CCGGCGATGTACCTGAATCTGTGCTCTCGAGAGCACAGATTCAGGTACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.2-411s1c1
Sequence:CCGGGTTTGATGAGGAGGACTATAACTCGAGTTATAGTCCTCCTCATCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053088.2-503s21c1
Sequence:CCGGGGGAGTTACAGCCTACTATAGCTCGAGCTATAGTAGGCTGTAACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-126s21c1
Sequence:CCGGCCCTACACCACGAGATCACATCTCGAGATGTGATCTCGTGGTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-411s21c1
Sequence:CCGGGTTTGATGAGGAGGACTATAACTCGAGTTATAGTCCTCCTCATCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-359s21c1
Sequence:CCGGCCTTGCACCTGTCCAAGTTAGCTCGAGCTAACTTGGACAGGTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.1-177s1c1
Sequence:CCGGGAATCTGTGCTGCCTTGGATTCTCGAGAATCCAAGGCAGCACAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-161s21c1
Sequence:CCGGTCAGCACGATGTACCTGAATCCTCGAGGATTCAGGTACATCGTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053088
IFITM5 MISSION shRNA Lentiviral Transduction Particles
interferon induced transmembrane protein 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.1-167s1c1
Sequence:CCGGCGATGTACCTGAATCTGTGCTCTCGAGAGCACAGATTCAGGTACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.2-411s1c1
Sequence:CCGGGTTTGATGAGGAGGACTATAACTCGAGTTATAGTCCTCCTCATCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053088.2-503s21c1
Sequence:CCGGGGGAGTTACAGCCTACTATAGCTCGAGCTATAGTAGGCTGTAACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-126s21c1
Sequence:CCGGCCCTACACCACGAGATCACATCTCGAGATGTGATCTCGTGGTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-411s21c1
Sequence:CCGGGTTTGATGAGGAGGACTATAACTCGAGTTATAGTCCTCCTCATCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-359s21c1
Sequence:CCGGCCTTGCACCTGTCCAAGTTAGCTCGAGCTAACTTGGACAGGTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053088.1-177s1c1
Sequence:CCGGGAATCTGTGCTGCCTTGGATTCTCGAGAATCCAAGGCAGCACAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053088.2-161s21c1
Sequence:CCGGTCAGCACGATGTACCTGAATCCTCGAGGATTCAGGTACATCGTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)