EMAIL THIS PAGE TO A FRIEND

IFNA14

interferon, alpha 14

34 Gene Product Result for
Synonyms: IFN-alphaH LEIF2H
UniProtKB ID: P01570, Q5VZ56, Q7M4S1
Gene ID:
Mouse(404549) interferon, alpha 14
domestic cat(493655) interferon, alpha 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_206975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_206975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110651 MISSION® esiRNA esiRNA human IFNA14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002172 Rosetta Predictions human pricing
NM_206975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211236 predicted 145
2 SASI_Hs01_00211237 predicted 168
3 SASI_Hs01_00211238 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115279 predicted 331
2 SASI_Mm01_00115280 predicted 324
3 SASI_Mm01_00115281 predicted 312
4 SASI_Mm01_00115278 predicted 324
5 SASI_Mm01_00115282 predicted 539
6 SASI_Mm01_00115283 predicted 529
7 SASI_Mm02_00351850 predicted 359
8 SASI_Mm02_00351851 predicted 363
9 SASI_Mm02_00351852 predicted 358
10 SASI_Mm01_00115284 predicted 115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002172
IFNA14 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-595s21c1
Sequence:CCGGGATTAAGGAGGAAGGATTGAACTCGAGTTCAATCCTTCCTCCTTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-480s21c1
Sequence:CCGGTACTTCCAAAGAATCACTCTTCTCGAGAAGAGTGATTCTTTGGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002172.1-692s1c1
Sequence:CCGGCATTTCAAAGACTCACTTCTACTCGAGTAGAAGTGAGTCTTTGAAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-242s1c1
Sequence:CCGGCCAGGAGGAATTTGATGGCAACTCGAGTTGCCATCAAATTCCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-149s1c1
Sequence:CCGGCCTGAATAACAGGAGGACTTTCTCGAGAAAGTCCTCCTGTTATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-120s1c1
Sequence:CCGGCTGGGCTGTAATCTGTCTCAACTCGAGTTGAGACAGATTACAGCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-308s1c1
Sequence:CCGGGCAGCAGACCTTCAATCTCTTCTCGAGAAGAGATTGAAGGTCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-539s21c1
Sequence:CCGGGGTTGTCAGAGCAGAAATCATCTCGAGATGATTTCTGCTCTGACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002172
IFNA14 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-595s21c1
Sequence:CCGGGATTAAGGAGGAAGGATTGAACTCGAGTTCAATCCTTCCTCCTTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-480s21c1
Sequence:CCGGTACTTCCAAAGAATCACTCTTCTCGAGAAGAGTGATTCTTTGGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002172.1-692s1c1
Sequence:CCGGCATTTCAAAGACTCACTTCTACTCGAGTAGAAGTGAGTCTTTGAAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-242s1c1
Sequence:CCGGCCAGGAGGAATTTGATGGCAACTCGAGTTGCCATCAAATTCCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-149s1c1
Sequence:CCGGCCTGAATAACAGGAGGACTTTCTCGAGAAAGTCCTCCTGTTATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-120s1c1
Sequence:CCGGCTGGGCTGTAATCTGTCTCAACTCGAGTTGAGACAGATTACAGCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-308s1c1
Sequence:CCGGGCAGCAGACCTTCAATCTCTTCTCGAGAAGAGATTGAAGGTCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-539s21c1
Sequence:CCGGGGTTGTCAGAGCAGAAATCATCTCGAGATGATTTCTGCTCTGACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002172
IFNA14 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-595s21c1
Sequence:CCGGGATTAAGGAGGAAGGATTGAACTCGAGTTCAATCCTTCCTCCTTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-480s21c1
Sequence:CCGGTACTTCCAAAGAATCACTCTTCTCGAGAAGAGTGATTCTTTGGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002172.1-692s1c1
Sequence:CCGGCATTTCAAAGACTCACTTCTACTCGAGTAGAAGTGAGTCTTTGAAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-242s1c1
Sequence:CCGGCCAGGAGGAATTTGATGGCAACTCGAGTTGCCATCAAATTCCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-149s1c1
Sequence:CCGGCCTGAATAACAGGAGGACTTTCTCGAGAAAGTCCTCCTGTTATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-120s1c1
Sequence:CCGGCTGGGCTGTAATCTGTCTCAACTCGAGTTGAGACAGATTACAGCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002172.1-308s1c1
Sequence:CCGGGCAGCAGACCTTCAATCTCTTCTCGAGAAGAGATTGAAGGTCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002172.2-539s21c1
Sequence:CCGGGGTTGTCAGAGCAGAAATCATCTCGAGATGATTTCTGCTCTGACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206975
IFNA14 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-107s1c1
Sequence:CCGGGAGCCTTGACACTTCTGGTAACTCGAGTTACCAGAAGTGTCAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-331s1c1
Sequence:CCGGGACCTCAACACTCAGCTCAATCTCGAGATTGAGCTGAGTGTTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-261s1c1
Sequence:CCGGCCTGACCCTCTTCACATCAAACTCGAGTTTGATGTGAAGAGGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-367s1c1
Sequence:CCGGCTGATGCAGCAGGTAGAGATACTCGAGTATCTCTACCTGCTGCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-320s1c1
Sequence:CCGGCCTTCTGCAATGACCTCAACACTCGAGTGTTGAGGTCATTGCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206975
IFNA14 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-107s1c1
Sequence:CCGGGAGCCTTGACACTTCTGGTAACTCGAGTTACCAGAAGTGTCAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-331s1c1
Sequence:CCGGGACCTCAACACTCAGCTCAATCTCGAGATTGAGCTGAGTGTTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-261s1c1
Sequence:CCGGCCTGACCCTCTTCACATCAAACTCGAGTTTGATGTGAAGAGGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-367s1c1
Sequence:CCGGCTGATGCAGCAGGTAGAGATACTCGAGTATCTCTACCTGCTGCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-320s1c1
Sequence:CCGGCCTTCTGCAATGACCTCAACACTCGAGTGTTGAGGTCATTGCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206975
IFNA14 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-107s1c1
Sequence:CCGGGAGCCTTGACACTTCTGGTAACTCGAGTTACCAGAAGTGTCAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-331s1c1
Sequence:CCGGGACCTCAACACTCAGCTCAATCTCGAGATTGAGCTGAGTGTTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-261s1c1
Sequence:CCGGCCTGACCCTCTTCACATCAAACTCGAGTTTGATGTGAAGAGGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-367s1c1
Sequence:CCGGCTGATGCAGCAGGTAGAGATACTCGAGTATCTCTACCTGCTGCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206975.1-320s1c1
Sequence:CCGGCCTTCTGCAATGACCTCAACACTCGAGTGTTGAGGTCATTGCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)