EMAIL THIS PAGE TO A FRIEND

IFNA17

interferon, alpha 17

15 Gene Product Result for
Synonyms: IFN-alphaI IFNA INFA LEIF2C1
Species: Human IFNA17(3451)
UniProtKB ID: P01571, Q14639, Q4KMT4, Q5VZ53, Q7M4Q4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021268 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021268 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093714 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021268
IFNA17 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021268.1-639s21c1
Sequence:CCGGATGATCCTGATTGACTAATACCTCGAGGTATTAGTCAATCAGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021268.1-752s21c1
Sequence:CCGGTGTAAAGAAGCGTCGTGTATACTCGAGTATACACGACGCTTCTTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021268.1-466s21c1
Sequence:CCGGCATCCTGGCTGTGAGGAAATACTCGAGTATTTCCTCACAGCCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021268.1-684s1c1
Sequence:CCGGCTCAATTTCAAAGACTCACTTCTCGAGAAGTGAGTCTTTGAAATTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-380s1c1
Sequence:CCGGGAACTTTACCAGCAACTGAATCTCGAGATTCAGTTGCTGGTAAAGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-142s1c1
Sequence:CCGGCCTGGGTAATAGGAGGGCCTTCTCGAGAAGGCCCTCCTATTACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-205s1c1
Sequence:CCGGCCTGAAGGACAGACATGACTTCTCGAGAAGTCATGTCTGTCCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-259s1c1
Sequence:CCGGGTTCCAGAAGACTCAAGCCATCTCGAGATGGCTTGAGTCTTCTGGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021268
IFNA17 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021268.1-639s21c1
Sequence:CCGGATGATCCTGATTGACTAATACCTCGAGGTATTAGTCAATCAGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021268.1-752s21c1
Sequence:CCGGTGTAAAGAAGCGTCGTGTATACTCGAGTATACACGACGCTTCTTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021268.1-466s21c1
Sequence:CCGGCATCCTGGCTGTGAGGAAATACTCGAGTATTTCCTCACAGCCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021268.1-684s1c1
Sequence:CCGGCTCAATTTCAAAGACTCACTTCTCGAGAAGTGAGTCTTTGAAATTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-380s1c1
Sequence:CCGGGAACTTTACCAGCAACTGAATCTCGAGATTCAGTTGCTGGTAAAGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-142s1c1
Sequence:CCGGCCTGGGTAATAGGAGGGCCTTCTCGAGAAGGCCCTCCTATTACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-205s1c1
Sequence:CCGGCCTGAAGGACAGACATGACTTCTCGAGAAGTCATGTCTGTCCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-259s1c1
Sequence:CCGGGTTCCAGAAGACTCAAGCCATCTCGAGATGGCTTGAGTCTTCTGGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021268
IFNA17 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021268.1-639s21c1
Sequence:CCGGATGATCCTGATTGACTAATACCTCGAGGTATTAGTCAATCAGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021268.1-752s21c1
Sequence:CCGGTGTAAAGAAGCGTCGTGTATACTCGAGTATACACGACGCTTCTTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021268.1-466s21c1
Sequence:CCGGCATCCTGGCTGTGAGGAAATACTCGAGTATTTCCTCACAGCCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021268.1-684s1c1
Sequence:CCGGCTCAATTTCAAAGACTCACTTCTCGAGAAGTGAGTCTTTGAAATTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-380s1c1
Sequence:CCGGGAACTTTACCAGCAACTGAATCTCGAGATTCAGTTGCTGGTAAAGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-142s1c1
Sequence:CCGGCCTGGGTAATAGGAGGGCCTTCTCGAGAAGGCCCTCCTATTACCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-205s1c1
Sequence:CCGGCCTGAAGGACAGACATGACTTCTCGAGAAGTCATGTCTGTCCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021268.1-259s1c1
Sequence:CCGGGTTCCAGAAGACTCAAGCCATCTCGAGATGGCTTGAGTCTTCTGGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)