EMAIL THIS PAGE TO A FRIEND

IFNA1

interferon, alpha 1

56 Gene Product Result for
Synonyms: IFL IFN IFN-ALPHA IFN-alphaD IFNA13 IFNA@
Gene ID:
Human(3439) Summary: The protein encoded by this gene is produced by macrophages and has antiviral activity. This gene is intronless and the encoded protein is secreted. [provided by RefSeq, Sep 2011]
Mouse(15962) interferon alpha 1
Rat(298210) interferon-alpha 1
domestic guinea pig(100725261) interferon, alpha 1
cow(281843) interferon, alpha, leukocyte
Horse(100053022) interferon, alpha 1
domestic cat(493765) interferon, alpha 1
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024013 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024013 Rosetta Predictions human pricing
NM_001014786 Rosetta Predictions rat pricing
XM_001052991 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028137 predicted 318
2 SASI_Hs01_00028138 predicted 209
3 SASI_Hs01_00028140 predicted 655
4 SASI_Hs01_00028142 predicted 648
5 SASI_Hs01_00028144 predicted 820
6 SASI_Hs01_00028139 predicted 678
7 SASI_Hs01_00028141 predicted 682
8 SASI_Hs01_00028136 predicted 365
9 SASI_Hs01_00028143 predicted 146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104356 predicted 261
2 SASI_Rn01_00104358 predicted 253
3 SASI_Rn01_00104361 predicted 345
4 SASI_Rn01_00104362 predicted 280
5 SASI_Rn01_00104357 predicted 222
6 SASI_Rn01_00104360 predicted 218
7 SASI_Rn01_00104364 predicted 321
8 SASI_Rn01_00104365 predicted 338
9 SASI_Rn02_00201896 predicted 333
10 SASI_Rn02_00201897 predicted 209
11 SASI_Rn01_00104359 predicted 263
12 SASI_Rn01_00104363 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270964 predicted 252
2 SASI_Rn02_00270965 predicted 246
3 SASI_Rn02_00270966 predicted 280
4 SASI_Rn02_00270967 predicted 345
5 SASI_Rn02_00270968 predicted 226
6 SASI_Rn02_00270969 predicted 303
7 SASI_Rn02_00270970 predicted 218
8 SASI_Rn02_00270971 predicted 293
9 SASI_Rn02_00270972 predicted 320
10 SASI_Rn02_00270973 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024013
IFNA1 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024013.1-723s1c1
Sequence:CCGGCCCTGCTATAACTATGACCATCTCGAGATGGTCATAGTTATAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-589s1c1
Sequence:CCGGCCTCTCTTTATCAACAAACTTCTCGAGAAGTTTGTTGATAAAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-505s1c1
Sequence:CCGGCTTCCGAAGAATCACTCTCTACTCGAGTAGAGAGTGATTCTTCGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-160s1c1
Sequence:CCGGCCTGGATAACAGGAGGACCTTCTCGAGAAGGTCCTCCTGTTATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-610s1c1
Sequence:CCGGGCAAGAAAGATTAAGGAGGAACTCGAGTTCCTCCTTAATCTTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024013.1-700s21c1
Sequence:CCGGTCTGTCATTTCAAAGACTCTCCTCGAGGAGAGTCTTTGAAATGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024013.1-657s21c1
Sequence:CCGGACAATTCTTATTGACTCATACCTCGAGGTATGAGTCAATAAGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024013.1-369s21c1
Sequence:CCGGATGAGGACCTCCTAGACAAATCTCGAGATTTGTCTAGGAGGTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024013
IFNA1 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024013.1-723s1c1
Sequence:CCGGCCCTGCTATAACTATGACCATCTCGAGATGGTCATAGTTATAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-589s1c1
Sequence:CCGGCCTCTCTTTATCAACAAACTTCTCGAGAAGTTTGTTGATAAAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-505s1c1
Sequence:CCGGCTTCCGAAGAATCACTCTCTACTCGAGTAGAGAGTGATTCTTCGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-160s1c1
Sequence:CCGGCCTGGATAACAGGAGGACCTTCTCGAGAAGGTCCTCCTGTTATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-610s1c1
Sequence:CCGGGCAAGAAAGATTAAGGAGGAACTCGAGTTCCTCCTTAATCTTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024013.1-700s21c1
Sequence:CCGGTCTGTCATTTCAAAGACTCTCCTCGAGGAGAGTCTTTGAAATGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024013.1-657s21c1
Sequence:CCGGACAATTCTTATTGACTCATACCTCGAGGTATGAGTCAATAAGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024013.1-369s21c1
Sequence:CCGGATGAGGACCTCCTAGACAAATCTCGAGATTTGTCTAGGAGGTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024013
IFNA1 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024013.1-723s1c1
Sequence:CCGGCCCTGCTATAACTATGACCATCTCGAGATGGTCATAGTTATAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-589s1c1
Sequence:CCGGCCTCTCTTTATCAACAAACTTCTCGAGAAGTTTGTTGATAAAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-505s1c1
Sequence:CCGGCTTCCGAAGAATCACTCTCTACTCGAGTAGAGAGTGATTCTTCGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-160s1c1
Sequence:CCGGCCTGGATAACAGGAGGACCTTCTCGAGAAGGTCCTCCTGTTATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024013.1-610s1c1
Sequence:CCGGGCAAGAAAGATTAAGGAGGAACTCGAGTTCCTCCTTAATCTTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024013.1-700s21c1
Sequence:CCGGTCTGTCATTTCAAAGACTCTCCTCGAGGAGAGTCTTTGAAATGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024013.1-657s21c1
Sequence:CCGGACAATTCTTATTGACTCATACCTCGAGGTATGAGTCAATAAGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024013.1-369s21c1
Sequence:CCGGATGAGGACCTCCTAGACAAATCTCGAGATTTGTCTAGGAGGTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010502
IFNA1 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-261s1c1
Sequence:CCGGCCTGAACATCTTCACATCAAACTCGAGTTTGATGTGAAGATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-309s1c1
Sequence:CCGGCCTCCTAGACTCATTCTGCAACTCGAGTTGCAGAATGAGTCTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-205s1c1
Sequence:CCGGCAGCAGATCAAGAAGGCTCAACTCGAGTTGAGCCTTCTTGATCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-420s1c1
Sequence:CCGGGCTGGCTGTGAGGAAATACTTCTCGAGAAGTATTTCCTCACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-110s1c1
Sequence:CCGGCCTTGACACTCCTGGTACAAACTCGAGTTTGTACCAGGAGTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-284s21c1
Sequence:CCGGACTCATCTGCTGCATGGAATACTCGAGTATTCCATGCAGCAGATGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-522s21c1
Sequence:CCGGCCTGTCTTCCTCTGCCAATGTCTCGAGACATTGGCAGAGGAAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-446s21c1
Sequence:CCGGGGATCACTGTGTACCTGAGAGCTCGAGCTCTCAGGTACACAGTGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010502
IFNA1 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-261s1c1
Sequence:CCGGCCTGAACATCTTCACATCAAACTCGAGTTTGATGTGAAGATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-309s1c1
Sequence:CCGGCCTCCTAGACTCATTCTGCAACTCGAGTTGCAGAATGAGTCTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-205s1c1
Sequence:CCGGCAGCAGATCAAGAAGGCTCAACTCGAGTTGAGCCTTCTTGATCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-420s1c1
Sequence:CCGGGCTGGCTGTGAGGAAATACTTCTCGAGAAGTATTTCCTCACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-110s1c1
Sequence:CCGGCCTTGACACTCCTGGTACAAACTCGAGTTTGTACCAGGAGTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-284s21c1
Sequence:CCGGACTCATCTGCTGCATGGAATACTCGAGTATTCCATGCAGCAGATGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-522s21c1
Sequence:CCGGCCTGTCTTCCTCTGCCAATGTCTCGAGACATTGGCAGAGGAAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-446s21c1
Sequence:CCGGGGATCACTGTGTACCTGAGAGCTCGAGCTCTCAGGTACACAGTGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010502
IFNA1 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-261s1c1
Sequence:CCGGCCTGAACATCTTCACATCAAACTCGAGTTTGATGTGAAGATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-309s1c1
Sequence:CCGGCCTCCTAGACTCATTCTGCAACTCGAGTTGCAGAATGAGTCTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-205s1c1
Sequence:CCGGCAGCAGATCAAGAAGGCTCAACTCGAGTTGAGCCTTCTTGATCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-420s1c1
Sequence:CCGGGCTGGCTGTGAGGAAATACTTCTCGAGAAGTATTTCCTCACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010502.1-110s1c1
Sequence:CCGGCCTTGACACTCCTGGTACAAACTCGAGTTTGTACCAGGAGTGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-284s21c1
Sequence:CCGGACTCATCTGCTGCATGGAATACTCGAGTATTCCATGCAGCAGATGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-522s21c1
Sequence:CCGGCCTGTCTTCCTCTGCCAATGTCTCGAGACATTGGCAGAGGAAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010502.2-446s21c1
Sequence:CCGGGGATCACTGTGTACCTGAGAGCTCGAGCTCTCAGGTACACAGTGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)