EMAIL THIS PAGE TO A FRIEND

IFNA21

interferon, alpha 21

22 Gene Product Result for
Synonyms: IFN-alphaI LeIF F leIF-F
UniProtKB ID: P01568, Q14608, Q5VWD1, Q7M4Q4
Gene ID:
Human(3452) Summary: This gene is a member of the alpha interferon gene cluster on the short arm of chromosome 9. Interferons are cytokines produced in response to viral infection that mediate the immune response and interfere with viral replication. The encoded protein is a type I interferon and may play a specific role in the antiviral response to rubella virus. [provided by RefSeq, Sep 2011]
cow(282256) interferon, alpha 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002175 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038429 predicted 629
2 SASI_Hs02_00333385 predicted 605
3 SASI_Hs01_00038428 predicted 366
4 SASI_Hs01_00038430 predicted 569
5 SASI_Hs01_00038431 predicted 583
6 SASI_Hs01_00038432 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002175
IFNA21 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002175.2-657s21c1
Sequence:CCGGACACCAGTCCACACTTCTATGCTCGAGCATAGAAGTGTGGACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002175.2-606s21c1
Sequence:CCGGGAGGAAGGAATGAAACCTGTTCTCGAGAACAGGTTTCATTCCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-260s1c1
Sequence:CCGGCCAGCAGACCTTCAATCTCTTCTCGAGAAGAGATTGAAGGTCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-407s1c1
Sequence:CCGGCCTGATGAATGTGGACTCCATCTCGAGATGGAGTCCACATTCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002175.2-805s21c1
Sequence:CCGGGACCATGCTGATAGATCTAATCTCGAGATTAGATCTATCAGCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-128s1c1
Sequence:CCGGCCTGGCACAAATGGGAAGAATCTCGAGATTCTTCCCATTTGTGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002175.1-672s1c1
Sequence:CCGGCCACCGCATGAGTTGAATCAACTCGAGTTGATTCAACTCATGCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-432s1c1
Sequence:CCGGGCTGTGAAGAAATACTTCCAACTCGAGTTGGAAGTATTTCTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002175
IFNA21 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002175.2-657s21c1
Sequence:CCGGACACCAGTCCACACTTCTATGCTCGAGCATAGAAGTGTGGACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002175.2-606s21c1
Sequence:CCGGGAGGAAGGAATGAAACCTGTTCTCGAGAACAGGTTTCATTCCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-260s1c1
Sequence:CCGGCCAGCAGACCTTCAATCTCTTCTCGAGAAGAGATTGAAGGTCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-407s1c1
Sequence:CCGGCCTGATGAATGTGGACTCCATCTCGAGATGGAGTCCACATTCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002175.2-805s21c1
Sequence:CCGGGACCATGCTGATAGATCTAATCTCGAGATTAGATCTATCAGCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-128s1c1
Sequence:CCGGCCTGGCACAAATGGGAAGAATCTCGAGATTCTTCCCATTTGTGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002175.1-672s1c1
Sequence:CCGGCCACCGCATGAGTTGAATCAACTCGAGTTGATTCAACTCATGCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-432s1c1
Sequence:CCGGGCTGTGAAGAAATACTTCCAACTCGAGTTGGAAGTATTTCTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002175
IFNA21 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002175.2-657s21c1
Sequence:CCGGACACCAGTCCACACTTCTATGCTCGAGCATAGAAGTGTGGACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002175.2-606s21c1
Sequence:CCGGGAGGAAGGAATGAAACCTGTTCTCGAGAACAGGTTTCATTCCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-260s1c1
Sequence:CCGGCCAGCAGACCTTCAATCTCTTCTCGAGAAGAGATTGAAGGTCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-407s1c1
Sequence:CCGGCCTGATGAATGTGGACTCCATCTCGAGATGGAGTCCACATTCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002175.2-805s21c1
Sequence:CCGGGACCATGCTGATAGATCTAATCTCGAGATTAGATCTATCAGCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-128s1c1
Sequence:CCGGCCTGGCACAAATGGGAAGAATCTCGAGATTCTTCCCATTTGTGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002175.1-672s1c1
Sequence:CCGGCCACCGCATGAGTTGAATCAACTCGAGTTGATTCAACTCATGCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002175.1-432s1c1
Sequence:CCGGGCTGTGAAGAAATACTTCCAACTCGAGTTGGAAGTATTTCTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)