EMAIL THIS PAGE TO A FRIEND

IFNA2

interferon, alpha 2

51 Gene Product Result for
Synonyms: IFN-alphaA IFNA IFNA2B INFA2
UniProtKB ID: P01563, P01564, Q14606, Q96KI6
Gene ID:
Human(3440) Summary: This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded protein is a cytokine produced in response to viral infection. Use of the recombinant form of this protein has been shown to be effective in reducing the symptoms and duration of the common cold. [provided by RefSeq, Jun 2011]
Mouse(15965) interferon alpha 2
Rat(298213) interferon alpha 2
domestic cat(493794) interferon, alpha 2
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000605 Rosetta Predictions human pricing
XM_233152 Rosetta Predictions rat pricing
NM_010503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100962 predicted 598
2 SASI_Hs01_00100963 predicted 729
3 SASI_Hs01_00100964 predicted 718
4 SASI_Hs01_00100965 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387470 predicted 225
2 SASI_Rn02_00387471 predicted 305
3 SASI_Rn02_00387472 predicted 213
4 SASI_Rn02_00387473 predicted 291
5 SASI_Rn02_00387474 predicted 304
6 SASI_Rn02_00387475 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086639 predicted 14
2 SASI_Mm01_00086642 predicted 12
3 SASI_Mm01_00086644 predicted 13
4 SASI_Mm01_00086638 predicted 253
5 SASI_Mm01_00086640 predicted 46
6 SASI_Mm01_00086641 predicted 18
7 SASI_Mm01_00086643 predicted 52
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000605
IFNA2 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-378s1c1
Sequence:CCGGCTAGACAAATTCTACACTGAACTCGAGTTCAGTGTAGAATTTGTCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000605.2-925s1c1
Sequence:CCGGGCACAGTGGTTAATGTAATAACTCGAGTTATTACATTAACCACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-489s1c1
Sequence:CCGGGCTGTGAGGAAATACTTCCAACTCGAGTTGGAAGTATTTCCTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000605.3-466s21c1
Sequence:CCGGTGATGAAGGAGGACTCCATTCCTCGAGGAATGGAGTCCTCCTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-605s1c1
Sequence:CCGGCTTGCAAGAAAGTTTAAGAAGCTCGAGCTTCTTAAACTTTCTTGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-305s1c1
Sequence:CCGGCCATGAGATGATCCAGCAGATCTCGAGATCTGCTGGATCATCTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000605.3-820s21c1
Sequence:CCGGCCATGCTGACTGATCCATTATCTCGAGATAATGGATCAGTCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000605.3-725s21c1
Sequence:CCGGTATGACCATGACACGATTTAACTCGAGTTAAATCGTGTCATGGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000605
IFNA2 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-378s1c1
Sequence:CCGGCTAGACAAATTCTACACTGAACTCGAGTTCAGTGTAGAATTTGTCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000605.2-925s1c1
Sequence:CCGGGCACAGTGGTTAATGTAATAACTCGAGTTATTACATTAACCACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-489s1c1
Sequence:CCGGGCTGTGAGGAAATACTTCCAACTCGAGTTGGAAGTATTTCCTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000605.3-466s21c1
Sequence:CCGGTGATGAAGGAGGACTCCATTCCTCGAGGAATGGAGTCCTCCTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-605s1c1
Sequence:CCGGCTTGCAAGAAAGTTTAAGAAGCTCGAGCTTCTTAAACTTTCTTGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-305s1c1
Sequence:CCGGCCATGAGATGATCCAGCAGATCTCGAGATCTGCTGGATCATCTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000605.3-820s21c1
Sequence:CCGGCCATGCTGACTGATCCATTATCTCGAGATAATGGATCAGTCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000605.3-725s21c1
Sequence:CCGGTATGACCATGACACGATTTAACTCGAGTTAAATCGTGTCATGGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000605
IFNA2 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-378s1c1
Sequence:CCGGCTAGACAAATTCTACACTGAACTCGAGTTCAGTGTAGAATTTGTCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000605.2-925s1c1
Sequence:CCGGGCACAGTGGTTAATGTAATAACTCGAGTTATTACATTAACCACTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-489s1c1
Sequence:CCGGGCTGTGAGGAAATACTTCCAACTCGAGTTGGAAGTATTTCCTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000605.3-466s21c1
Sequence:CCGGTGATGAAGGAGGACTCCATTCCTCGAGGAATGGAGTCCTCCTTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-605s1c1
Sequence:CCGGCTTGCAAGAAAGTTTAAGAAGCTCGAGCTTCTTAAACTTTCTTGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000605.2-305s1c1
Sequence:CCGGCCATGAGATGATCCAGCAGATCTCGAGATCTGCTGGATCATCTCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000605.3-820s21c1
Sequence:CCGGCCATGCTGACTGATCCATTATCTCGAGATAATGGATCAGTCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000605.3-725s21c1
Sequence:CCGGTATGACCATGACACGATTTAACTCGAGTTAAATCGTGTCATGGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010503
IFNA2 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-420s1c1
Sequence:CCGGGCTGGCTGTGAGGAAATATTTCTCGAGAAATATTTCCTCACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-341s1c1
Sequence:CCGGAGCAGCTCAATGACCTGCAAACTCGAGTTTGCAGGTCATTGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-278s1c1
Sequence:CCGGCAAAGGCTTCATCTGCTGCTTCTCGAGAAGCAGCAGATGAAGCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-192s1c1
Sequence:CCGGGAAGGTGGATAACCAGCAGATCTCGAGATCTGCTGGTTATCCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-27s1c1
Sequence:CCGGGATGCTGATAGTGATGAGCTACTCGAGTAGCTCATCACTATCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010503.2-111s21c1
Sequence:CCGGCTTGAAGGTCCTGGCACAGATCTCGAGATCTGTGCCAGGACCTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010503.2-246s21c1
Sequence:CCGGTCTTACTCAGCAGACCTTGAACTCGAGTTCAAGGTCTGCTGAGTAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010503
IFNA2 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-420s1c1
Sequence:CCGGGCTGGCTGTGAGGAAATATTTCTCGAGAAATATTTCCTCACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-341s1c1
Sequence:CCGGAGCAGCTCAATGACCTGCAAACTCGAGTTTGCAGGTCATTGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-278s1c1
Sequence:CCGGCAAAGGCTTCATCTGCTGCTTCTCGAGAAGCAGCAGATGAAGCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-192s1c1
Sequence:CCGGGAAGGTGGATAACCAGCAGATCTCGAGATCTGCTGGTTATCCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-27s1c1
Sequence:CCGGGATGCTGATAGTGATGAGCTACTCGAGTAGCTCATCACTATCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010503.2-111s21c1
Sequence:CCGGCTTGAAGGTCCTGGCACAGATCTCGAGATCTGTGCCAGGACCTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010503.2-246s21c1
Sequence:CCGGTCTTACTCAGCAGACCTTGAACTCGAGTTCAAGGTCTGCTGAGTAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010503
IFNA2 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-420s1c1
Sequence:CCGGGCTGGCTGTGAGGAAATATTTCTCGAGAAATATTTCCTCACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-341s1c1
Sequence:CCGGAGCAGCTCAATGACCTGCAAACTCGAGTTTGCAGGTCATTGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-278s1c1
Sequence:CCGGCAAAGGCTTCATCTGCTGCTTCTCGAGAAGCAGCAGATGAAGCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-192s1c1
Sequence:CCGGGAAGGTGGATAACCAGCAGATCTCGAGATCTGCTGGTTATCCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010503.1-27s1c1
Sequence:CCGGGATGCTGATAGTGATGAGCTACTCGAGTAGCTCATCACTATCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010503.2-111s21c1
Sequence:CCGGCTTGAAGGTCCTGGCACAGATCTCGAGATCTGTGCCAGGACCTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010503.2-246s21c1
Sequence:CCGGTCTTACTCAGCAGACCTTGAACTCGAGTTCAAGGTCTGCTGAGTAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)