EMAIL THIS PAGE TO A FRIEND

IFNA4

interferon, alpha 4

44 Gene Product Result for
Synonyms: IFN-alpha4a INFA4
UniProtKB ID: P05014, P13358, Q14CS4, Q5VV15
Gene ID:
Mouse(15967) interferon alpha 4
Rat(298205) interferon, alpha 4
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160231 MISSION® esiRNA esiRNA targeting mouse Ifna4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001106667 Rosetta Predictions rat pricing
NM_010504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221198 predicted 245
2 SASI_Rn02_00221199 predicted 283
3 SASI_Rn02_00221200 predicted 349
4 SASI_Rn02_00221201 predicted 215
5 SASI_Rn02_00221202 predicted 273
6 SASI_Rn02_00221203 predicted 334
7 SASI_Rn02_00221204 predicted 259
8 SASI_Rn02_00221205 predicted 339
9 SASI_Rn02_00221206 predicted 253
10 SASI_Rn02_00221207 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318759 predicted 266
2 SASI_Mm01_00087562 predicted 273
3 SASI_Mm01_00087563 predicted 261
4 SASI_Mm01_00087565 predicted 275
5 SASI_Mm02_00318760 predicted 402
6 SASI_Mm01_00087566 predicted 111
7 SASI_Mm01_00087568 predicted 157
8 SASI_Mm02_00318761 predicted 52
9 SASI_Mm02_00318762 predicted 546
10 SASI_Mm01_00087569 predicted 84
11 SASI_Mm01_00087560 predicted 223
12 SASI_Mm01_00087561 predicted 225
13 SASI_Mm01_00087564 predicted 227
14 SASI_Mm01_00087567 predicted 15
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021068
IFNA4 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021068.1-766s1c1
Sequence:CCGGCATGAGTTCTTCCATTTCAAACTCGAGTTTGAAATGGAAGAACTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-560s1c1
Sequence:CCGGCCTGGCTGTGAGGAAATACTTCTCGAGAAGTATTTCCTCACAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-501s1c1
Sequence:CCGGGCATGTGTGATACAGGAGGTTCTCGAGAACCTCCTGTATCACACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-296s1c1
Sequence:CCGGCCTGAAGGACAGACATGATTTCTCGAGAAATCATGTCTGTCCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-578s1c1
Sequence:CCGGCTTCCAAAGAATCACTCTTTACTCGAGTAAAGAGTGATTCTTTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021068.2-771s21c1
Sequence:CCGGTGTGAAGAAGCTTGGTGTATACTCGAGTATACACCAAGCTTCTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021068.2-179s21c1
Sequence:CCGGCTTGATACTCCTGGCACAAATCTCGAGATTTGTGCCAGGAGTATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021068.2-664s21c1
Sequence:CCGGCTGATTGACTAATACATTATCCTCGAGGATAATGTATTAGTCAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021068
IFNA4 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021068.1-766s1c1
Sequence:CCGGCATGAGTTCTTCCATTTCAAACTCGAGTTTGAAATGGAAGAACTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-560s1c1
Sequence:CCGGCCTGGCTGTGAGGAAATACTTCTCGAGAAGTATTTCCTCACAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-501s1c1
Sequence:CCGGGCATGTGTGATACAGGAGGTTCTCGAGAACCTCCTGTATCACACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-296s1c1
Sequence:CCGGCCTGAAGGACAGACATGATTTCTCGAGAAATCATGTCTGTCCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-578s1c1
Sequence:CCGGCTTCCAAAGAATCACTCTTTACTCGAGTAAAGAGTGATTCTTTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021068.2-771s21c1
Sequence:CCGGTGTGAAGAAGCTTGGTGTATACTCGAGTATACACCAAGCTTCTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021068.2-179s21c1
Sequence:CCGGCTTGATACTCCTGGCACAAATCTCGAGATTTGTGCCAGGAGTATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021068.2-664s21c1
Sequence:CCGGCTGATTGACTAATACATTATCCTCGAGGATAATGTATTAGTCAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021068
IFNA4 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021068.1-766s1c1
Sequence:CCGGCATGAGTTCTTCCATTTCAAACTCGAGTTTGAAATGGAAGAACTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-560s1c1
Sequence:CCGGCCTGGCTGTGAGGAAATACTTCTCGAGAAGTATTTCCTCACAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-501s1c1
Sequence:CCGGGCATGTGTGATACAGGAGGTTCTCGAGAACCTCCTGTATCACACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-296s1c1
Sequence:CCGGCCTGAAGGACAGACATGATTTCTCGAGAAATCATGTCTGTCCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021068.1-578s1c1
Sequence:CCGGCTTCCAAAGAATCACTCTTTACTCGAGTAAAGAGTGATTCTTTGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021068.2-771s21c1
Sequence:CCGGTGTGAAGAAGCTTGGTGTATACTCGAGTATACACCAAGCTTCTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021068.2-179s21c1
Sequence:CCGGCTTGATACTCCTGGCACAAATCTCGAGATTTGTGCCAGGAGTATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021068.2-664s21c1
Sequence:CCGGCTGATTGACTAATACATTATCCTCGAGGATAATGTATTAGTCAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010504
IFNA4 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000089318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-30s1c1
Sequence:CCGGCCTAGTAATGATGAGCTACTACTCGAGTAGTAGCTCATCATTACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-159s1c1
Sequence:CCGGCCTGAAGGACAGGAAGGATTTCTCGAGAAATCCTTCCTGTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-229s1c1
Sequence:CCGGGCCATCCTTGTGCTAAGAGATCTCGAGATCTCTTAGCACAAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-113s1c1
Sequence:CCGGCCTTGACAGTCCTGGAAGAAACTCGAGTTTCTTCCAGGACTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010504
IFNA4 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000089318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-30s1c1
Sequence:CCGGCCTAGTAATGATGAGCTACTACTCGAGTAGTAGCTCATCATTACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-159s1c1
Sequence:CCGGCCTGAAGGACAGGAAGGATTTCTCGAGAAATCCTTCCTGTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-229s1c1
Sequence:CCGGGCCATCCTTGTGCTAAGAGATCTCGAGATCTCTTAGCACAAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-113s1c1
Sequence:CCGGCCTTGACAGTCCTGGAAGAAACTCGAGTTTCTTCCAGGACTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010504
IFNA4 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000089318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-30s1c1
Sequence:CCGGCCTAGTAATGATGAGCTACTACTCGAGTAGTAGCTCATCATTACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-159s1c1
Sequence:CCGGCCTGAAGGACAGGAAGGATTTCTCGAGAAATCCTTCCTGTCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-229s1c1
Sequence:CCGGGCCATCCTTGTGCTAAGAGATCTCGAGATCTCTTAGCACAAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010504.1-113s1c1
Sequence:CCGGCCTTGACAGTCCTGGAAGAAACTCGAGTTTCTTCCAGGACTGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)