EMAIL THIS PAGE TO A FRIEND

IFNA5

interferon, alpha 5

38 Gene Product Result for
Synonyms: IFN-alpha-5 IFN-alphaG INA5 INFA5 leIF G
UniProtKB ID: P01569, Q52LX3
Gene ID:
Mouse(15968) interferon alpha 5
Rat(690894) interferon alpha family, gene 5
dog(442934) interferon, alpha 5
cow(281844) interferon, alpha 5
domestic cat(493840) interferon, alpha 5
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002169 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU171311 MISSION® esiRNA esiRNA targeting mouse Ifna5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002169 Rosetta Predictions human pricing
XM_001076062 Rosetta Predictions rat pricing
NM_010505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013114 predicted 300
2 SASI_Hs01_00013115 predicted 297
3 SASI_Hs01_00013116 predicted 295
4 SASI_Hs01_00013117 predicted 291
5 SASI_Hs01_00013118 predicted 404
6 SASI_Hs01_00013119 predicted 108
7 SASI_Hs01_00013120 predicted 413
8 SASI_Hs01_00013121 predicted 100
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351963 predicted 211
2 SASI_Rn02_00351964 predicted 225
3 SASI_Rn02_00351965 predicted 214
4 SASI_Rn02_00351966 predicted 225
5 SASI_Rn02_00351967 predicted 308
6 SASI_Rn02_00351968 predicted 303
7 SASI_Rn02_00351969 predicted 211
8 SASI_Rn02_00351970 predicted 339
9 SASI_Rn02_00351971 predicted 225
10 SASI_Rn02_00351972 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123722 predicted 63
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010505
IFNA5 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010505.2-304s21c1
Sequence:CCGGGCAACCCTCCTAGACTCATTCCTCGAGGAATGAGTCTAGGAGGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010505.2-535s21c1
Sequence:CCGGGTTAACTTGCTGGCAAGATTGCTCGAGCAATCTTGCCAGCAAGTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-61s1c1
Sequence:CCGGTCTCTAGGATGTGACCTTCTTCTCGAGAAGAAGGTCACATCCTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-331s1c1
Sequence:CCGGGAAGTCCATCAGCAGCTCAATCTCGAGATTGAGCTGCTGATGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-71s1c1
Sequence:CCGGGTGACCTTCTTCAGACTCATACTCGAGTATGAGTCTGAAGAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-340s1c1
Sequence:CCGGCAGCAGCTCAATGACCTCAAACTCGAGTTTGAGGTCATTGAGCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-174s1c1
Sequence:CCGGCTTTGGATTCCCACAGGAGAACTCGAGTTCTCCTGTGGGAATCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010505
IFNA5 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010505.2-304s21c1
Sequence:CCGGGCAACCCTCCTAGACTCATTCCTCGAGGAATGAGTCTAGGAGGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010505.2-535s21c1
Sequence:CCGGGTTAACTTGCTGGCAAGATTGCTCGAGCAATCTTGCCAGCAAGTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-61s1c1
Sequence:CCGGTCTCTAGGATGTGACCTTCTTCTCGAGAAGAAGGTCACATCCTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-331s1c1
Sequence:CCGGGAAGTCCATCAGCAGCTCAATCTCGAGATTGAGCTGCTGATGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-71s1c1
Sequence:CCGGGTGACCTTCTTCAGACTCATACTCGAGTATGAGTCTGAAGAAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-340s1c1
Sequence:CCGGCAGCAGCTCAATGACCTCAAACTCGAGTTTGAGGTCATTGAGCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-174s1c1
Sequence:CCGGCTTTGGATTCCCACAGGAGAACTCGAGTTCTCCTGTGGGAATCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010505
IFNA5 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010505.2-304s21c1
Sequence:CCGGGCAACCCTCCTAGACTCATTCCTCGAGGAATGAGTCTAGGAGGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010505.2-535s21c1
Sequence:CCGGGTTAACTTGCTGGCAAGATTGCTCGAGCAATCTTGCCAGCAAGTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-61s1c1
Sequence:CCGGTCTCTAGGATGTGACCTTCTTCTCGAGAAGAAGGTCACATCCTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-331s1c1
Sequence:CCGGGAAGTCCATCAGCAGCTCAATCTCGAGATTGAGCTGCTGATGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-71s1c1
Sequence:CCGGGTGACCTTCTTCAGACTCATACTCGAGTATGAGTCTGAAGAAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-340s1c1
Sequence:CCGGCAGCAGCTCAATGACCTCAAACTCGAGTTTGAGGTCATTGAGCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010505.1-174s1c1
Sequence:CCGGCTTTGGATTCCCACAGGAGAACTCGAGTTCTCCTGTGGGAATCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002169
IFNA5 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-318s21c1
Sequence:CCGGCAAATTCTACACTGAACTTTACTCGAGTAAAGTTCAGTGTAGAATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-262s21c1
Sequence:CCGGTTCAATCTCTTCAGCACAAAGCTCGAGCTTTGTGCTGAAGAGATTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-118s21c1
Sequence:CCGGATAATGGCACAAATGGGAAGACTCGAGTCTTCCCATTTGTGCCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-384s1c1
Sequence:CCGGAGTGGAAGACACTCCTCTGATCTCGAGATCAGAGGAGTGTCTTCCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-295s1c1
Sequence:CCGGACTTGGGATGAGACACTTCTACTCGAGTAGAAGTGTCTCATCCCAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-41s1c1
Sequence:CCGGTCAACTGCAAGTCAATCTGTTCTCGAGAACAGATTGACTTGCAGTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-408s1c1
Sequence:CCGGTGTGGACTCTATCCTGACTGTCTCGAGACAGTCAGGATAGAGTCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-93s1c1
Sequence:CCGGCCTGAGTAACAGGAGGACTTTCTCGAGAAAGTCCTCCTGTTACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002169
IFNA5 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-318s21c1
Sequence:CCGGCAAATTCTACACTGAACTTTACTCGAGTAAAGTTCAGTGTAGAATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-262s21c1
Sequence:CCGGTTCAATCTCTTCAGCACAAAGCTCGAGCTTTGTGCTGAAGAGATTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-118s21c1
Sequence:CCGGATAATGGCACAAATGGGAAGACTCGAGTCTTCCCATTTGTGCCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-384s1c1
Sequence:CCGGAGTGGAAGACACTCCTCTGATCTCGAGATCAGAGGAGTGTCTTCCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-295s1c1
Sequence:CCGGACTTGGGATGAGACACTTCTACTCGAGTAGAAGTGTCTCATCCCAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-41s1c1
Sequence:CCGGTCAACTGCAAGTCAATCTGTTCTCGAGAACAGATTGACTTGCAGTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-408s1c1
Sequence:CCGGTGTGGACTCTATCCTGACTGTCTCGAGACAGTCAGGATAGAGTCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-93s1c1
Sequence:CCGGCCTGAGTAACAGGAGGACTTTCTCGAGAAAGTCCTCCTGTTACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002169
IFNA5 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-318s21c1
Sequence:CCGGCAAATTCTACACTGAACTTTACTCGAGTAAAGTTCAGTGTAGAATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-262s21c1
Sequence:CCGGTTCAATCTCTTCAGCACAAAGCTCGAGCTTTGTGCTGAAGAGATTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002169.1-118s21c1
Sequence:CCGGATAATGGCACAAATGGGAAGACTCGAGTCTTCCCATTTGTGCCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-384s1c1
Sequence:CCGGAGTGGAAGACACTCCTCTGATCTCGAGATCAGAGGAGTGTCTTCCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-295s1c1
Sequence:CCGGACTTGGGATGAGACACTTCTACTCGAGTAGAAGTGTCTCATCCCAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-41s1c1
Sequence:CCGGTCAACTGCAAGTCAATCTGTTCTCGAGAACAGATTGACTTGCAGTTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-408s1c1
Sequence:CCGGTGTGGACTCTATCCTGACTGTCTCGAGACAGTCAGGATAGAGTCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002169.1-93s1c1
Sequence:CCGGCCTGAGTAACAGGAGGACTTTCTCGAGAAAGTCCTCCTGTTACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)