EMAIL THIS PAGE TO A FRIEND

IFNA6

interferon, alpha 6

39 Gene Product Result for
Synonyms: IFN-alphaK
UniProtKB ID: P05013, Q5VYQ1
Gene ID:
Mouse(15969) interferon alpha 6
dog(444848) interferon, alpha 6
domestic cat(493841) interferon, alpha 6
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106581 MISSION® esiRNA esiRNA human IFNA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021002 Rosetta Predictions human pricing
NM_008335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134949 predicted 317
2 SASI_Hs01_00134951 predicted 302
3 SASI_Hs01_00134953 predicted 302
4 SASI_Hs01_00134954 predicted 309
5 SASI_Hs01_00134955 predicted 288
6 SASI_Hs01_00134950 predicted 296
7 SASI_Hs01_00134952 predicted 309
8 SASI_Hs01_00134956 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117769 predicted 664
2 SASI_Mm01_00117770 predicted 652
3 SASI_Mm01_00117771 predicted 701
4 SASI_Mm01_00117772 predicted 668
5 SASI_Mm01_00117773 predicted 841
6 SASI_Mm01_00117774 predicted 906
7 SASI_Mm01_00117775 predicted 913
8 SASI_Mm01_00117776 predicted 764
9 SASI_Mm01_00117777 predicted 799
10 SASI_Mm01_00117778 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021002
IFNA6 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-295s1c1
Sequence:CCGGGCTTGGGATGAGAGGCTTCTACTCGAGTAGAAGCCTCTCATCCCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-333s21c1
Sequence:CCGGACTTTACCAGCAGCTGAATGACTCGAGTCATTCAGCTGCTGGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-163s1c1
Sequence:CCGGGACAGACATGACTTCAGATTTCTCGAGAAATCTGAAGTCATGTCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-260s1c1
Sequence:CCGGCCTTCAATCTCTTCAGCACAACTCGAGTTGTGCTGAAGAGATTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-120s1c1
Sequence:CCGGCCTGGCACAAATGAGGAGAATCTCGAGATTCTCCTCATTTGTGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-233s21c1
Sequence:CCGGCTGTCCTCCATGAGGTGATTCCTCGAGGAATCACCTCATGGAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-307s1c1
Sequence:CCGGAGGCTTCTAGACAAACTCTATCTCGAGATAGAGTTTGTCTAGAAGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-96s21c1
Sequence:CCGGGGGTCACAGGAGGACCATGATCTCGAGATCATGGTCCTCCTGTGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021002
IFNA6 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-295s1c1
Sequence:CCGGGCTTGGGATGAGAGGCTTCTACTCGAGTAGAAGCCTCTCATCCCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-333s21c1
Sequence:CCGGACTTTACCAGCAGCTGAATGACTCGAGTCATTCAGCTGCTGGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-163s1c1
Sequence:CCGGGACAGACATGACTTCAGATTTCTCGAGAAATCTGAAGTCATGTCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-260s1c1
Sequence:CCGGCCTTCAATCTCTTCAGCACAACTCGAGTTGTGCTGAAGAGATTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-120s1c1
Sequence:CCGGCCTGGCACAAATGAGGAGAATCTCGAGATTCTCCTCATTTGTGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-233s21c1
Sequence:CCGGCTGTCCTCCATGAGGTGATTCCTCGAGGAATCACCTCATGGAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-307s1c1
Sequence:CCGGAGGCTTCTAGACAAACTCTATCTCGAGATAGAGTTTGTCTAGAAGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-96s21c1
Sequence:CCGGGGGTCACAGGAGGACCATGATCTCGAGATCATGGTCCTCCTGTGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021002
IFNA6 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-295s1c1
Sequence:CCGGGCTTGGGATGAGAGGCTTCTACTCGAGTAGAAGCCTCTCATCCCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-333s21c1
Sequence:CCGGACTTTACCAGCAGCTGAATGACTCGAGTCATTCAGCTGCTGGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-163s1c1
Sequence:CCGGGACAGACATGACTTCAGATTTCTCGAGAAATCTGAAGTCATGTCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-260s1c1
Sequence:CCGGCCTTCAATCTCTTCAGCACAACTCGAGTTGTGCTGAAGAGATTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-120s1c1
Sequence:CCGGCCTGGCACAAATGAGGAGAATCTCGAGATTCTCCTCATTTGTGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-233s21c1
Sequence:CCGGCTGTCCTCCATGAGGTGATTCCTCGAGGAATCACCTCATGGAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021002.1-307s1c1
Sequence:CCGGAGGCTTCTAGACAAACTCTATCTCGAGATAGAGTTTGTCTAGAAGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021002.1-96s21c1
Sequence:CCGGGGGTCACAGGAGGACCATGATCTCGAGATCATGGTCCTCCTGTGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008335
IFNA6 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008335.1-700s1c1
Sequence:CCGGGCTCCCTTTACAACTCTCATTCTCGAGAATGAGAGTTGTAAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-616s1c1
Sequence:CCGGCAAGACTGAATGAGGACGAGTCTCGAGACTCGTCCTCATTCAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-224s1c1
Sequence:CCGGCCTGAAGGACAGAAAGGACTTCTCGAGAAGTCCTTTCTGTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-497s1c1
Sequence:CCGGGAGGACATACTTCCACAGGATCTCGAGATCCTGTGGAAGTATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-162s1c1
Sequence:CCGGCTCAGGAACAAGAGAGCCTTACTCGAGTAAGGCTCTCTTGTTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008335
IFNA6 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008335.1-700s1c1
Sequence:CCGGGCTCCCTTTACAACTCTCATTCTCGAGAATGAGAGTTGTAAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-616s1c1
Sequence:CCGGCAAGACTGAATGAGGACGAGTCTCGAGACTCGTCCTCATTCAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-224s1c1
Sequence:CCGGCCTGAAGGACAGAAAGGACTTCTCGAGAAGTCCTTTCTGTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-497s1c1
Sequence:CCGGGAGGACATACTTCCACAGGATCTCGAGATCCTGTGGAAGTATGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-162s1c1
Sequence:CCGGCTCAGGAACAAGAGAGCCTTACTCGAGTAAGGCTCTCTTGTTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008335
IFNA6 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008335.1-700s1c1
Sequence:CCGGGCTCCCTTTACAACTCTCATTCTCGAGAATGAGAGTTGTAAAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-616s1c1
Sequence:CCGGCAAGACTGAATGAGGACGAGTCTCGAGACTCGTCCTCATTCAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-224s1c1
Sequence:CCGGCCTGAAGGACAGAAAGGACTTCTCGAGAAGTCCTTTCTGTCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-497s1c1
Sequence:CCGGGAGGACATACTTCCACAGGATCTCGAGATCCTGTGGAAGTATGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008335.1-162s1c1
Sequence:CCGGCTCAGGAACAAGAGAGCCTTACTCGAGTAAGGCTCTCTTGTTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)