EMAIL THIS PAGE TO A FRIEND

IFNA7

interferon, alpha 7

24 Gene Product Result for
Synonyms: IFN-alphaJ IFNA-J
UniProtKB ID: P01567, Q14607, Q5VV14
Gene ID:
Mouse(15970) interferon alpha 7
domestic cat(493653) interferon, alpha 7
dog(474181) interferon, alpha 7
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304954 ANTI-IFNA7 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2101132 Anti-IFNA7 antibody produced in rabbit affinity isolated antibody mouse, pig, human, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203401 MISSION® esiRNA esiRNA targeting mouse Ifna7 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_008334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077182 predicted 220
2 SASI_Mm01_00077183 predicted 219
3 SASI_Mm01_00077181 predicted 221
4 SASI_Mm01_00077184 predicted 72
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021057
IFNA7 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-289s21c1
Sequence:CCGGGATCCAGCAGACCTTCAATCTCTCGAGAGATTGAAGGTCTGCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-123s21c1
Sequence:CCGGAGACCCACAGCCTGCGTAATACTCGAGTATTACGCAGGCTGTGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-219s21c1
Sequence:CCGGGATTCCCAGAGGAGGAGTTTGCTCGAGCAAACTCCTCCTCTGGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-485s21c1
Sequence:CCGGAGAATCACTCTTTATCTAATGCTCGAGCATTAGATAAAGAGTGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-208s1c1
Sequence:CCGGACATGAATTCAGATTCCCGGACTCGAGTCCGGGAATCTGAATTCATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-71s1c1
Sequence:CCGGGTGCTGGTACTCAGCTACAAACTCGAGTTTGTAGCTGAGTACCAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-504s1c1
Sequence:CCGGCAGAGAAGAAATACAGCCCTTCTCGAGAAGGGCTGTATTTCTTCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-181s1c1
Sequence:CCGGCTCTCCTTTCTCCTGCTTGAACTCGAGTTCAAGCAGGAGAAAGGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-439s1c1
Sequence:CCGGCCTGATGAATGAGGACTTCATCTCGAGATGAAGTCCTCATTCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021057
IFNA7 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-289s21c1
Sequence:CCGGGATCCAGCAGACCTTCAATCTCTCGAGAGATTGAAGGTCTGCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-123s21c1
Sequence:CCGGAGACCCACAGCCTGCGTAATACTCGAGTATTACGCAGGCTGTGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-219s21c1
Sequence:CCGGGATTCCCAGAGGAGGAGTTTGCTCGAGCAAACTCCTCCTCTGGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-485s21c1
Sequence:CCGGAGAATCACTCTTTATCTAATGCTCGAGCATTAGATAAAGAGTGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-208s1c1
Sequence:CCGGACATGAATTCAGATTCCCGGACTCGAGTCCGGGAATCTGAATTCATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-71s1c1
Sequence:CCGGGTGCTGGTACTCAGCTACAAACTCGAGTTTGTAGCTGAGTACCAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-504s1c1
Sequence:CCGGCAGAGAAGAAATACAGCCCTTCTCGAGAAGGGCTGTATTTCTTCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-181s1c1
Sequence:CCGGCTCTCCTTTCTCCTGCTTGAACTCGAGTTCAAGCAGGAGAAAGGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-439s1c1
Sequence:CCGGCCTGATGAATGAGGACTTCATCTCGAGATGAAGTCCTCATTCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021057
IFNA7 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-289s21c1
Sequence:CCGGGATCCAGCAGACCTTCAATCTCTCGAGAGATTGAAGGTCTGCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-123s21c1
Sequence:CCGGAGACCCACAGCCTGCGTAATACTCGAGTATTACGCAGGCTGTGGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-219s21c1
Sequence:CCGGGATTCCCAGAGGAGGAGTTTGCTCGAGCAAACTCCTCCTCTGGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021057.2-485s21c1
Sequence:CCGGAGAATCACTCTTTATCTAATGCTCGAGCATTAGATAAAGAGTGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-208s1c1
Sequence:CCGGACATGAATTCAGATTCCCGGACTCGAGTCCGGGAATCTGAATTCATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-71s1c1
Sequence:CCGGGTGCTGGTACTCAGCTACAAACTCGAGTTTGTAGCTGAGTACCAGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-504s1c1
Sequence:CCGGCAGAGAAGAAATACAGCCCTTCTCGAGAAGGGCTGTATTTCTTCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-181s1c1
Sequence:CCGGCTCTCCTTTCTCCTGCTTGAACTCGAGTTCAAGCAGGAGAAAGGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021057.1-439s1c1
Sequence:CCGGCCTGATGAATGAGGACTTCATCTCGAGATGAAGTCCTCATTCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008334
IFNA7 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-217s1c1
Sequence:CCGGGAGGCTCAAGCCCTCTGTGTTCTCGAGAACACAGAGGGCTTGAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-278s1c1
Sequence:CCGGCAAAGGACTCATCTGCTGCTTCTCGAGAAGCAGCAGATGAGTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-252s1c1
Sequence:CCGGCCAGCAGATCCTGAACATCTTCTCGAGAAGATGTTCAGGATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-420s1c1
Sequence:CCGGGCTGGCTGTGAGGACATACTTCTCGAGAAGTATGTCCTCACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-51s1c1
Sequence:CCGGGCCAACCTGCTCTCTAGGATACTCGAGTATCCTAGAGAGCAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008334
IFNA7 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-217s1c1
Sequence:CCGGGAGGCTCAAGCCCTCTGTGTTCTCGAGAACACAGAGGGCTTGAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-278s1c1
Sequence:CCGGCAAAGGACTCATCTGCTGCTTCTCGAGAAGCAGCAGATGAGTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-252s1c1
Sequence:CCGGCCAGCAGATCCTGAACATCTTCTCGAGAAGATGTTCAGGATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-420s1c1
Sequence:CCGGGCTGGCTGTGAGGACATACTTCTCGAGAAGTATGTCCTCACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-51s1c1
Sequence:CCGGGCCAACCTGCTCTCTAGGATACTCGAGTATCCTAGAGAGCAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008334
IFNA7 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-217s1c1
Sequence:CCGGGAGGCTCAAGCCCTCTGTGTTCTCGAGAACACAGAGGGCTTGAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-278s1c1
Sequence:CCGGCAAAGGACTCATCTGCTGCTTCTCGAGAAGCAGCAGATGAGTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-252s1c1
Sequence:CCGGCCAGCAGATCCTGAACATCTTCTCGAGAAGATGTTCAGGATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-420s1c1
Sequence:CCGGGCTGGCTGTGAGGACATACTTCTCGAGAAGTATGTCCTCACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008334.2-51s1c1
Sequence:CCGGGCCAACCTGCTCTCTAGGATACTCGAGTATCCTAGAGAGCAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)