EMAIL THIS PAGE TO A FRIEND

IFNA8

interferon, alpha 8

25 Gene Product Result for
Synonyms: IFN-alphaB
UniProtKB ID: P32881, P01565, P09236, Q5VWV7, Q5VYQ3
Gene ID:
domestic cat(493648) interferon, alpha 8
dog(474182) interferon, alpha 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002170 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002170 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193488 predicted 336
2 SASI_Hs01_00193489 predicted 548
3 SASI_Hs01_00193490 predicted 323
4 SASI_Hs01_00193491 predicted 428
5 SASI_Hs01_00193492 predicted 599
6 SASI_Hs01_00193493 predicted 647
7 SASI_Hs02_00333384 predicted 694
8 SASI_Hs01_00193494 predicted 616
9 SASI_Hs01_00193495 predicted 597
10 SASI_Hs01_00193496 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002170
IFNA8 MISSION shRNA Bacterial Glycerol Stock
interferon, alpha 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002170.2-711s1c1
Sequence:CCGGCCATGCTATGAATTGAATCAACTCGAGTTGATTCAATTCATAGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-89s1c1
Sequence:CCGGCTACAAGTCATTCAGCTCTCTCTCGAGAGAGAGCTGAATGACTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-230s1c1
Sequence:CCGGCCAGGAGGAGTTTGATGATAACTCGAGTTATCATCAAACTCCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-347s1c1
Sequence:CCGGTGAGACCCTTCTAGATGAATTCTCGAGAATTCATCTAGAAGGGTCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-164s1c1
Sequence:CCGGCCTGGCACAAATGCGAAGAATCTCGAGATTCTTCGCATTTGTGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002170.3-601s21c1
Sequence:CCGGGACCTGGTACAACACGGAAATCTCGAGATTTCCGTGTTGTACCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002170.3-548s21c1
Sequence:CCGGGATCCTTCTCTTTATCAATCACTCGAGTGATTGATAAAGAGAAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002170.3-838s21c1
Sequence:CCGGTAACTATCTATAGGGCTTAAACTCGAGTTTAAGCCCTATAGATAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002170
IFNA8 MISSION shRNA shRNA Plasmid DNA
interferon, alpha 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002170.2-711s1c1
Sequence:CCGGCCATGCTATGAATTGAATCAACTCGAGTTGATTCAATTCATAGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-89s1c1
Sequence:CCGGCTACAAGTCATTCAGCTCTCTCTCGAGAGAGAGCTGAATGACTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-230s1c1
Sequence:CCGGCCAGGAGGAGTTTGATGATAACTCGAGTTATCATCAAACTCCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-347s1c1
Sequence:CCGGTGAGACCCTTCTAGATGAATTCTCGAGAATTCATCTAGAAGGGTCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-164s1c1
Sequence:CCGGCCTGGCACAAATGCGAAGAATCTCGAGATTCTTCGCATTTGTGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002170.3-601s21c1
Sequence:CCGGGACCTGGTACAACACGGAAATCTCGAGATTTCCGTGTTGTACCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002170.3-548s21c1
Sequence:CCGGGATCCTTCTCTTTATCAATCACTCGAGTGATTGATAAAGAGAAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002170.3-838s21c1
Sequence:CCGGTAACTATCTATAGGGCTTAAACTCGAGTTTAAGCCCTATAGATAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002170
IFNA8 MISSION shRNA Lentiviral Transduction Particles
interferon, alpha 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002170.2-711s1c1
Sequence:CCGGCCATGCTATGAATTGAATCAACTCGAGTTGATTCAATTCATAGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-89s1c1
Sequence:CCGGCTACAAGTCATTCAGCTCTCTCTCGAGAGAGAGCTGAATGACTTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-230s1c1
Sequence:CCGGCCAGGAGGAGTTTGATGATAACTCGAGTTATCATCAAACTCCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-347s1c1
Sequence:CCGGTGAGACCCTTCTAGATGAATTCTCGAGAATTCATCTAGAAGGGTCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002170.2-164s1c1
Sequence:CCGGCCTGGCACAAATGCGAAGAATCTCGAGATTCTTCGCATTTGTGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002170.3-601s21c1
Sequence:CCGGGACCTGGTACAACACGGAAATCTCGAGATTTCCGTGTTGTACCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002170.3-548s21c1
Sequence:CCGGGATCCTTCTCTTTATCAATCACTCGAGTGATTGATAAAGAGAAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002170.3-838s21c1
Sequence:CCGGTAACTATCTATAGGGCTTAAACTCGAGTTTAAGCCCTATAGATAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)