EMAIL THIS PAGE TO A FRIEND

IFNAR1

interferon (alpha, beta and omega) receptor 1

83 Gene Product Result for
Synonyms: AVP IFN-alpha-REC IFNAR IFNBR IFRC
Gene ID:
Human(3454) Summary: The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. [provided by RefSeq, Jul 2008]
Mouse(15975) interferon (alpha and beta) receptor 1
Rat(288264) interferon (alpha, beta and omega) receptor 1
chicken(395665) interferon (alpha, beta and omega) receptor 1
domestic cat(101092535) interferon (alpha, beta and omega) receptor 1
cow(282257) interferon (alpha, beta and omega) receptor 1
dog(609830) interferon (alpha, beta and omega) receptor 1
domestic guinea pig(100715784) interferon (alpha, beta and omega) receptor 1
naked mole-rat(101724158) interferon (alpha, beta and omega) receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000629 Rosetta Predictions human pricing
NM_001105893 Rosetta Predictions rat pricing
NM_010508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302973 predicted 1135
2 SASI_Hs01_00121376 predicted 1059
3 SASI_Hs01_00121377 predicted 781
4 SASI_Hs01_00121378 predicted 1739
5 SASI_Hs01_00121380 predicted 482
6 SASI_Hs01_00121381 predicted 1305
7 SASI_Hs01_00121385 predicted 1663
8 SASI_Hs02_00302974 predicted 1351
9 SASI_Hs02_00302975 predicted 804
10 SASI_Hs02_00302976 predicted 1571
11 SASI_Hs01_00121379 predicted 891
12 SASI_Hs01_00121382 predicted 1174
13 SASI_Hs01_00121383 predicted 601
14 SASI_Hs01_00121384 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213572 predicted 2150
2 SASI_Rn02_00213573 predicted 1855
3 SASI_Rn02_00213574 predicted 1327
4 SASI_Rn02_00213575 predicted 1506
5 SASI_Rn02_00213576 predicted 1021
6 SASI_Rn02_00213577 predicted 1562
7 SASI_Rn02_00213578 predicted 1107
8 SASI_Rn02_00213579 predicted 1189
9 SASI_Rn02_00213580 predicted 1337
10 SASI_Rn02_00213581 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026315 predicted 1416
2 SASI_Mm02_00318763 predicted 213
3 SASI_Mm01_00026317 predicted 814
4 SASI_Mm01_00026318 predicted 1014
5 SASI_Mm01_00026320 predicted 1187
6 SASI_Mm01_00026321 predicted 655
7 SASI_Mm01_00026322 predicted 597
8 SASI_Mm02_00318764 predicted 710
9 SASI_Mm01_00026324 predicted 1593
10 SASI_Mm02_00318765 predicted 377
11 SASI_Mm01_00026316 predicted 1400
12 SASI_Mm01_00026319 predicted 1177
13 SASI_Mm01_00026323 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010508
VALIDATED
IFNAR1 MISSION shRNA Bacterial Glycerol Stock
interferon (alpha, beta and omega) receptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-673s1c1
Sequence:CCGGGCCAGAGACTACTTACTGTTTCTCGAGAAACAGTAAGTAGTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-1315s1c1
Sequence:CCGGGCTGAATAAGACCAGCAACTTCTCGAGAAGTTGCTGGTCTTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-942s1c1
Sequence:CCGGCCTGTGCAAATGTCCAGACTACTCGAGTAGTCTGGACATTTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-202s1c1
Sequence:CCGGCGTCTACATTATAGATGACAACTCGAGTTGTCATCTATAATGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-1561s1c1
Sequence:CCGGGCACACGGAAAGATGCTTCATCTCGAGATGAAGCATCTTTCCGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-237s21c1
Sequence:CCGGCGTCTACATTATAGATGACAACTCGAGTTGTCATCTATAATGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010508.2-1596s21c1
Sequence:CCGGGCACACGGAAAGATGCTTCATCTCGAGATGAAGCATCTTTCCGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-708s21c1
Sequence:CCGGGCCAGAGACTACTTACTGTTTCTCGAGAAACAGTAAGTAGTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-471s21c1
Sequence:CCGGGAATGAGGTTGATCCGTTTATCTCGAGATAAACGGATCAACCTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010508
VALIDATED
IFNAR1 MISSION shRNA shRNA Plasmid DNA
interferon (alpha, beta and omega) receptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-673s1c1
Sequence:CCGGGCCAGAGACTACTTACTGTTTCTCGAGAAACAGTAAGTAGTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-1315s1c1
Sequence:CCGGGCTGAATAAGACCAGCAACTTCTCGAGAAGTTGCTGGTCTTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-942s1c1
Sequence:CCGGCCTGTGCAAATGTCCAGACTACTCGAGTAGTCTGGACATTTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-202s1c1
Sequence:CCGGCGTCTACATTATAGATGACAACTCGAGTTGTCATCTATAATGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-1561s1c1
Sequence:CCGGGCACACGGAAAGATGCTTCATCTCGAGATGAAGCATCTTTCCGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-237s21c1
Sequence:CCGGCGTCTACATTATAGATGACAACTCGAGTTGTCATCTATAATGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010508.2-1596s21c1
Sequence:CCGGGCACACGGAAAGATGCTTCATCTCGAGATGAAGCATCTTTCCGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-708s21c1
Sequence:CCGGGCCAGAGACTACTTACTGTTTCTCGAGAAACAGTAAGTAGTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-471s21c1
Sequence:CCGGGAATGAGGTTGATCCGTTTATCTCGAGATAAACGGATCAACCTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010508
VALIDATED
IFNAR1 MISSION shRNA Lentiviral Transduction Particles
interferon (alpha, beta and omega) receptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-673s1c1
Sequence:CCGGGCCAGAGACTACTTACTGTTTCTCGAGAAACAGTAAGTAGTCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-1315s1c1
Sequence:CCGGGCTGAATAAGACCAGCAACTTCTCGAGAAGTTGCTGGTCTTATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-942s1c1
Sequence:CCGGCCTGTGCAAATGTCCAGACTACTCGAGTAGTCTGGACATTTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-202s1c1
Sequence:CCGGCGTCTACATTATAGATGACAACTCGAGTTGTCATCTATAATGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010508.1-1561s1c1
Sequence:CCGGGCACACGGAAAGATGCTTCATCTCGAGATGAAGCATCTTTCCGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-237s21c1
Sequence:CCGGCGTCTACATTATAGATGACAACTCGAGTTGTCATCTATAATGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010508.2-1596s21c1
Sequence:CCGGGCACACGGAAAGATGCTTCATCTCGAGATGAAGCATCTTTCCGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-708s21c1
Sequence:CCGGGCCAGAGACTACTTACTGTTTCTCGAGAAACAGTAAGTAGTCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010508.2-471s21c1
Sequence:CCGGGAATGAGGTTGATCCGTTTATCTCGAGATAAACGGATCAACCTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000629
VALIDATED
IFNAR1 MISSION shRNA Bacterial Glycerol Stock
interferon (alpha, beta and omega) receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1742s1c1
Sequence:CCGGGCCAAGATTCAGGAAATTATTCTCGAGAATAATTTCCTGAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1492s1c1
Sequence:CCGGGCTCTCCCGTTTGTCATTTATCTCGAGATAAATGACAAACGGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-496s1c1
Sequence:CCGGGTTGACTCATTTACACCATTTCTCGAGAAATGGTGTAAATGAGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000629.2-261s1c1
Sequence:CCGGCGACATCATAGATGACAACTTCTCGAGAAGTTGTCATCTATGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1170s1c1
Sequence:CCGGCCTTAGTGATTCATTCCATATCTCGAGATATGGAATGAATCACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000629.2-721s21c1
Sequence:CCGGCTCTCACCAGAGACTACTTATCTCGAGATAAGTAGTCTCTGGTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000629.2-2266s21c1
Sequence:CCGGGACAGCGTGAGACTCTTTAAACTCGAGTTTAAAGAGTCTCACGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000629.2-1828s21c1
Sequence:CCGGATGAACTGTGTCAAGTATAAGCTCGAGCTTATACTTGACACAGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000629
VALIDATED
IFNAR1 MISSION shRNA shRNA Plasmid DNA
interferon (alpha, beta and omega) receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1742s1c1
Sequence:CCGGGCCAAGATTCAGGAAATTATTCTCGAGAATAATTTCCTGAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1492s1c1
Sequence:CCGGGCTCTCCCGTTTGTCATTTATCTCGAGATAAATGACAAACGGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-496s1c1
Sequence:CCGGGTTGACTCATTTACACCATTTCTCGAGAAATGGTGTAAATGAGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000629.2-261s1c1
Sequence:CCGGCGACATCATAGATGACAACTTCTCGAGAAGTTGTCATCTATGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1170s1c1
Sequence:CCGGCCTTAGTGATTCATTCCATATCTCGAGATATGGAATGAATCACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000629.2-721s21c1
Sequence:CCGGCTCTCACCAGAGACTACTTATCTCGAGATAAGTAGTCTCTGGTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000629.2-2266s21c1
Sequence:CCGGGACAGCGTGAGACTCTTTAAACTCGAGTTTAAAGAGTCTCACGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000629.2-1828s21c1
Sequence:CCGGATGAACTGTGTCAAGTATAAGCTCGAGCTTATACTTGACACAGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000629
VALIDATED
IFNAR1 MISSION shRNA Lentiviral Transduction Particles
interferon (alpha, beta and omega) receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1742s1c1
Sequence:CCGGGCCAAGATTCAGGAAATTATTCTCGAGAATAATTTCCTGAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1492s1c1
Sequence:CCGGGCTCTCCCGTTTGTCATTTATCTCGAGATAAATGACAAACGGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-496s1c1
Sequence:CCGGGTTGACTCATTTACACCATTTCTCGAGAAATGGTGTAAATGAGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000629.2-261s1c1
Sequence:CCGGCGACATCATAGATGACAACTTCTCGAGAAGTTGTCATCTATGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000629.2-1170s1c1
Sequence:CCGGCCTTAGTGATTCATTCCATATCTCGAGATATGGAATGAATCACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000629.2-721s21c1
Sequence:CCGGCTCTCACCAGAGACTACTTATCTCGAGATAAGTAGTCTCTGGTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000629.2-2266s21c1
Sequence:CCGGGACAGCGTGAGACTCTTTAAACTCGAGTTTAAAGAGTCTCACGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000629.2-1828s21c1
Sequence:CCGGATGAACTGTGTCAAGTATAAGCTCGAGCTTATACTTGACACAGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)