EMAIL THIS PAGE TO A FRIEND

IFNAR2

interferon (alpha, beta and omega) receptor 2

140 Gene Product Result for
Synonyms: IFN-R IFN-alpha-REC IFNABR IFNARB
UniProtKB ID: P48551, A8KAJ4, D3DSE8, D3DSE9, Q15467, Q6FHD7
Gene ID:
Human(3455) Summary: The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15976) interferon (alpha and beta) receptor 2
Rat(686326) interferon (alpha, beta and omega) receptor 2
sheep(443363) interferon (alpha, beta and omega) receptor 2
domestic guinea pig(100716349) interferon (alpha, beta and omega) receptor 2
naked mole-rat(101722391) interferon (alpha, beta and omega) receptor 2
chicken(395664) interferon (alpha, beta and omega) receptor 2
cow(282258) interferon (alpha, beta and omega) receptor 2
Horse(100052489) interferon (alpha, beta and omega) receptor 2
domestic cat(100500726) interferon (alpha, beta and omega) receptor 2
domestic cat(101090285) interferon (alpha, beta and omega) receptor 2
dog(487737) interferon (alpha, beta and omega) receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0679 Human IFNAR2 / Interferon Alpha/Beta Receptor 2 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000874 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000874 Rosetta Predictions human pricing
NM_207584 Rosetta Predictions human pricing
NM_207585 Rosetta Predictions human pricing
XM_001073550 Rosetta Predictions rat pricing
NM_001110498 Rosetta Predictions mouse pricing
NM_010509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208505 predicted 781
2 SASI_Hs01_00208506 predicted 906
3 SASI_Hs01_00208507 predicted 560
4 SASI_Hs01_00208508 predicted 560
5 SASI_Hs01_00208509 predicted 599
6 SASI_Hs01_00208510 predicted 956
7 SASI_Hs01_00208511 predicted 571
8 SASI_Hs01_00208512 predicted 843
9 SASI_Hs01_00208513 predicted 825
10 SASI_Hs02_00303408 predicted 545
11 SASI_Hs01_00208504 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011629 predicted 736
2 SASI_Hs01_00011630 predicted 856
3 SASI_Hs01_00011631 predicted 509
4 SASI_Hs01_00011632 predicted 519
5 SASI_Hs01_00011633 predicted 545
6 SASI_Hs01_00011634 predicted 906
7 SASI_Hs01_00011635 predicted 526
8 SASI_Hs01_00011636 predicted 801
9 SASI_Hs01_00011637 predicted 782
10 SASI_Hs02_00374153 predicted 502
11 SASI_Hs01_00011628 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246657 predicted 735
2 SASI_Hs01_00246658 predicted 861
3 SASI_Hs01_00246659 predicted 512
4 SASI_Hs01_00246660 predicted 517
5 SASI_Hs01_00246661 predicted 546
6 SASI_Hs01_00246662 predicted 915
7 SASI_Hs01_00246663 predicted 527
8 SASI_Hs01_00246664 predicted 798
9 SASI_Hs01_00246665 predicted 780
10 SASI_Hs02_00374154 predicted 506
11 SASI_Hs01_00246656 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343134 predicted 1767
2 SASI_Rn02_00343135 predicted 1305
3 SASI_Rn02_00343136 predicted 429
4 SASI_Rn02_00343137 predicted 370
5 SASI_Rn02_00343138 predicted 890
6 SASI_Rn02_00343139 predicted 925
7 SASI_Rn02_00343140 predicted 923
8 SASI_Rn02_00343141 predicted 700
9 SASI_Rn02_00343142 predicted 1010
10 SASI_Rn02_00343143 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305548 predicted 424
2 SASI_Mm02_00305549 predicted 569
3 SASI_Mm02_00305550 predicted 603
4 SASI_Mm02_00305551 predicted 514
5 SASI_Mm02_00305552 predicted 735
6 SASI_Mm02_00305553 predicted 539
7 SASI_Mm02_00305554 predicted 748
8 SASI_Mm02_00305555 predicted 559
9 SASI_Mm02_00305556 predicted 329
10 SASI_Mm02_00305557 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067656 predicted 424
2 SASI_Mm02_00318766 predicted 568
3 SASI_Mm02_00318767 predicted 602
4 SASI_Mm01_00067660 predicted 520
5 SASI_Mm02_00318768 predicted 735
6 SASI_Mm02_00318769 predicted 539
7 SASI_Mm01_00067662 predicted 754
8 SASI_Mm02_00318770 predicted 557
9 SASI_Mm02_00318771 predicted 331
10 SASI_Mm02_00318772 predicted 399
11 SASI_Mm01_00067657 predicted 841
12 SASI_Mm01_00067658 predicted 1749
13 SASI_Mm01_00067659 predicted 1425
14 SASI_Mm01_00067661 predicted 963
15 SASI_Mm01_00067663 predicted 1034
16 SASI_Mm01_00067664 predicted 439
17 SASI_Mm01_00067665 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010509
VALIDATED
IFNAR2 MISSION shRNA Bacterial Glycerol Stock
interferon (alpha, beta and omega) receptor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-2015s21c1
Sequence:CCGGCTCTATGCAGATTGACAATTTCTCGAGAAATTGTCAATCTGCATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-1095s21c1
Sequence:CCGGTTTCGTGAGCACTATCGTAATCTCGAGATTACGATAGTGCTCACGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-433s21c1
Sequence:CCGGCCAGATGAACCTTGCACTATACTCGAGTATAGTGCAAGGTTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-1125s21c1
Sequence:CCGGGATTGGTTATATATGCCTAAACTCGAGTTTAGGCATATATAACCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-323s1c1
Sequence:CCGGCCAGATGAACCTTGCACTATACTCGAGTATAGTGCAAGGTTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-1052s1c1
Sequence:CCGGGTCTTGAACTTCCGCCACTTTCTCGAGAAAGTGGCGGAAGTTCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-736s21c1
Sequence:CCGGCCGCCAGAATTTGAGATCGTTCTCGAGAACGATCTCAAATTCTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-2063s1c1
Sequence:CCGGCCCTATGTTGTTTCTAGGAAACTCGAGTTTCCTAGAAACAACATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-1501s1c1
Sequence:CCGGCGTGAACTTAAACTCTGTGTTCTCGAGAACACAGAGTTTAAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-626s1c1
Sequence:CCGGCCGCCAGAATTTGAGATCGTTCTCGAGAACGATCTCAAATTCTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010509
VALIDATED
IFNAR2 MISSION shRNA shRNA Plasmid DNA
interferon (alpha, beta and omega) receptor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-2015s21c1
Sequence:CCGGCTCTATGCAGATTGACAATTTCTCGAGAAATTGTCAATCTGCATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-1095s21c1
Sequence:CCGGTTTCGTGAGCACTATCGTAATCTCGAGATTACGATAGTGCTCACGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-433s21c1
Sequence:CCGGCCAGATGAACCTTGCACTATACTCGAGTATAGTGCAAGGTTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-1125s21c1
Sequence:CCGGGATTGGTTATATATGCCTAAACTCGAGTTTAGGCATATATAACCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-323s1c1
Sequence:CCGGCCAGATGAACCTTGCACTATACTCGAGTATAGTGCAAGGTTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-1052s1c1
Sequence:CCGGGTCTTGAACTTCCGCCACTTTCTCGAGAAAGTGGCGGAAGTTCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-736s21c1
Sequence:CCGGCCGCCAGAATTTGAGATCGTTCTCGAGAACGATCTCAAATTCTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-2063s1c1
Sequence:CCGGCCCTATGTTGTTTCTAGGAAACTCGAGTTTCCTAGAAACAACATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-1501s1c1
Sequence:CCGGCGTGAACTTAAACTCTGTGTTCTCGAGAACACAGAGTTTAAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-626s1c1
Sequence:CCGGCCGCCAGAATTTGAGATCGTTCTCGAGAACGATCTCAAATTCTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010509
VALIDATED
IFNAR2 MISSION shRNA Lentiviral Transduction Particles
interferon (alpha, beta and omega) receptor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-2015s21c1
Sequence:CCGGCTCTATGCAGATTGACAATTTCTCGAGAAATTGTCAATCTGCATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-1095s21c1
Sequence:CCGGTTTCGTGAGCACTATCGTAATCTCGAGATTACGATAGTGCTCACGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-433s21c1
Sequence:CCGGCCAGATGAACCTTGCACTATACTCGAGTATAGTGCAAGGTTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-1125s21c1
Sequence:CCGGGATTGGTTATATATGCCTAAACTCGAGTTTAGGCATATATAACCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-323s1c1
Sequence:CCGGCCAGATGAACCTTGCACTATACTCGAGTATAGTGCAAGGTTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-1052s1c1
Sequence:CCGGGTCTTGAACTTCCGCCACTTTCTCGAGAAAGTGGCGGAAGTTCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.2-736s21c1
Sequence:CCGGCCGCCAGAATTTGAGATCGTTCTCGAGAACGATCTCAAATTCTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-2063s1c1
Sequence:CCGGCCCTATGTTGTTTCTAGGAAACTCGAGTTTCCTAGAAACAACATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-1501s1c1
Sequence:CCGGCGTGAACTTAAACTCTGTGTTCTCGAGAACACAGAGTTTAAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_010509.1-626s1c1
Sequence:CCGGCCGCCAGAATTTGAGATCGTTCTCGAGAACGATCTCAAATTCTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000874
VALIDATED
IFNAR2 MISSION shRNA Bacterial Glycerol Stock
interferon (alpha, beta and omega) receptor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-430s21c1
Sequence:CCGGTGTATATCAGCCTCGTGTTTGCTCGAGCAAACACGAGGCTGATATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-910s21c1
Sequence:CCGGAGAAGCATAAACCCGAAATAACTCGAGTTATTTCGGGTTTATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-941s21c1
Sequence:CCGGGAGTGGAAATTTCACCTATATCTCGAGATATAGGTGAAATTTCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-630s21c1
Sequence:CCGGGCAAATACCACAAGATCATTTCTCGAGAAATGATCTTGTGGTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-523s1c1
Sequence:CCGGCCATCTTATCATGGGAATTAACTCGAGTTAATTCCCATGATAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-497s21c1
Sequence:CCGGCAAGATATCATTGCGAAATTTCTCGAGAAATTTCGCAATGATATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-837s1c1
Sequence:CCGGCCATCTATTGTTGAGGAAGAACTCGAGTTCTTCCTCAACAATAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-466s1c1
Sequence:CCGGCGCCTGATTACACAGATGAATCTCGAGATTCATCTGTGTAATCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-1029s1c1
Sequence:CCGGGCAGTAATAAAGTCTCCCTTACTCGAGTAAGGGAGACTTTATTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-600s1c1
Sequence:CCGGCCAGAAGATTTGAAGGTGGTTCTCGAGAACCACCTTCAAATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000874
VALIDATED
IFNAR2 MISSION shRNA shRNA Plasmid DNA
interferon (alpha, beta and omega) receptor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-430s21c1
Sequence:CCGGTGTATATCAGCCTCGTGTTTGCTCGAGCAAACACGAGGCTGATATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-910s21c1
Sequence:CCGGAGAAGCATAAACCCGAAATAACTCGAGTTATTTCGGGTTTATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-941s21c1
Sequence:CCGGGAGTGGAAATTTCACCTATATCTCGAGATATAGGTGAAATTTCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-630s21c1
Sequence:CCGGGCAAATACCACAAGATCATTTCTCGAGAAATGATCTTGTGGTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-523s1c1
Sequence:CCGGCCATCTTATCATGGGAATTAACTCGAGTTAATTCCCATGATAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-497s21c1
Sequence:CCGGCAAGATATCATTGCGAAATTTCTCGAGAAATTTCGCAATGATATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-837s1c1
Sequence:CCGGCCATCTATTGTTGAGGAAGAACTCGAGTTCTTCCTCAACAATAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-466s1c1
Sequence:CCGGCGCCTGATTACACAGATGAATCTCGAGATTCATCTGTGTAATCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-1029s1c1
Sequence:CCGGGCAGTAATAAAGTCTCCCTTACTCGAGTAAGGGAGACTTTATTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-600s1c1
Sequence:CCGGCCAGAAGATTTGAAGGTGGTTCTCGAGAACCACCTTCAAATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000874
VALIDATED
IFNAR2 MISSION shRNA Lentiviral Transduction Particles
interferon (alpha, beta and omega) receptor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-430s21c1
Sequence:CCGGTGTATATCAGCCTCGTGTTTGCTCGAGCAAACACGAGGCTGATATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-910s21c1
Sequence:CCGGAGAAGCATAAACCCGAAATAACTCGAGTTATTTCGGGTTTATGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-941s21c1
Sequence:CCGGGAGTGGAAATTTCACCTATATCTCGAGATATAGGTGAAATTTCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-630s21c1
Sequence:CCGGGCAAATACCACAAGATCATTTCTCGAGAAATGATCTTGTGGTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-523s1c1
Sequence:CCGGCCATCTTATCATGGGAATTAACTCGAGTTAATTCCCATGATAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-497s21c1
Sequence:CCGGCAAGATATCATTGCGAAATTTCTCGAGAAATTTCGCAATGATATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-837s1c1
Sequence:CCGGCCATCTATTGTTGAGGAAGAACTCGAGTTCTTCCTCAACAATAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-466s1c1
Sequence:CCGGCGCCTGATTACACAGATGAATCTCGAGATTCATCTGTGTAATCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-1029s1c1
Sequence:CCGGGCAGTAATAAAGTCTCCCTTACTCGAGTAAGGGAGACTTTATTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_000874.3-600s1c1
Sequence:CCGGCCAGAAGATTTGAAGGTGGTTCTCGAGAACCACCTTCAAATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)