EMAIL THIS PAGE TO A FRIEND

IFNB1

interferon, beta 1, fibroblast

82 Gene Product Result for
Synonyms: IFB IFF IFNB
UniProtKB ID: P01574
Gene ID:
Mouse(15977) interferon beta 1, fibroblast
Rat(24481) interferon beta 1, fibroblast
domestic cat(493849) interferon, beta 1, fibroblast
Horse(100052545) interferon, beta 1, fibroblast
dog(481558) interferon, beta 1, fibroblast
cow(281845) interferon, beta 1, fibroblast
domestic guinea pig(100734449) interferon, beta 1, fibroblast
naked mole-rat(101699042) interferon, beta 1, fibroblast
Gene Class: Apoptosis, Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002176 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150861 MISSION® esiRNA esiRNA human IFNB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002176 Rosetta Predictions human pricing
NM_019127 Rosetta Predictions rat pricing
NM_010510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103614 predicted 196
2 SASI_Hs01_00103615 predicted 399
3 SASI_Hs01_00103616 predicted 390
4 SASI_Hs02_00333386 predicted 317
5 SASI_Hs01_00103617 predicted 296
6 SASI_Hs01_00103618 predicted 295
7 SASI_Hs01_00103619 predicted 400
8 SASI_Hs02_00333387 predicted 228
9 SASI_Hs01_00103623 predicted 321
10 SASI_Hs02_00333388 predicted 503
11 SASI_Hs01_00103620 predicted 395
12 SASI_Hs01_00103621 predicted 309
13 SASI_Hs01_00103622 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086285 predicted 226
2 SASI_Rn01_00086287 predicted 289
3 SASI_Rn02_00261863 predicted 286
4 SASI_Rn01_00086288 predicted 230
5 SASI_Rn01_00086289 predicted 289
6 SASI_Rn01_00086290 predicted 211
7 SASI_Rn01_00086292 predicted 297
8 SASI_Rn01_00086294 predicted 295
9 SASI_Rn02_00261864 predicted 298
10 SASI_Rn02_00261865 predicted 315
11 SASI_Rn01_00086286 predicted 216
12 SASI_Rn01_00086291 predicted 243
13 SASI_Rn01_00086293 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041314 predicted 460
2 SASI_Mm02_00318773 predicted 442
3 SASI_Mm01_00041315 predicted 297
4 SASI_Mm01_00041316 predicted 383
5 SASI_Mm01_00041317 predicted 409
6 SASI_Mm01_00041318 predicted 307
7 SASI_Mm01_00041319 predicted 437
8 SASI_Mm01_00041320 predicted 458
9 SASI_Mm01_00041321 predicted 394
10 SASI_Mm01_00041323 predicted 414
11 SASI_Mm01_00041322 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010510
IFNB1 MISSION shRNA Bacterial Glycerol Stock
interferon, beta 1, fibroblast
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010510.1-575s1c1
Sequence:CCGGTGTCAGTTGATGCCTCAGAATCTCGAGATTCTGAGGCATCAACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-423s1c1
Sequence:CCGGGCTCTCCACTTGAAGAGCTATCTCGAGATAGCTCTTCAAGTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-510s1c1
Sequence:CCGGGCAGAGATCTTCAGGAACTTTCTCGAGAAAGTTCCTGAAGATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-221s1c1
Sequence:CCGGGCAGAAGAGTTACACTGCCTTCTCGAGAAGGCAGTGTAACTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-104s1c1
Sequence:CCGGGCTCCAAGAAAGGACGAACATCTCGAGATGTTCGTCCTTTCTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010510.1-183s21c1
Sequence:CCGGGCGGACTTCAAGATCCCTATGCTCGAGCATAGGGATCTTGAAGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010510.1-74s21c1
Sequence:CCGGAGCCCTCTCCATCAACTATAACTCGAGTTATAGTTGATGGAGAGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010510
IFNB1 MISSION shRNA shRNA Plasmid DNA
interferon, beta 1, fibroblast
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010510.1-575s1c1
Sequence:CCGGTGTCAGTTGATGCCTCAGAATCTCGAGATTCTGAGGCATCAACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-423s1c1
Sequence:CCGGGCTCTCCACTTGAAGAGCTATCTCGAGATAGCTCTTCAAGTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-510s1c1
Sequence:CCGGGCAGAGATCTTCAGGAACTTTCTCGAGAAAGTTCCTGAAGATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-221s1c1
Sequence:CCGGGCAGAAGAGTTACACTGCCTTCTCGAGAAGGCAGTGTAACTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-104s1c1
Sequence:CCGGGCTCCAAGAAAGGACGAACATCTCGAGATGTTCGTCCTTTCTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010510.1-183s21c1
Sequence:CCGGGCGGACTTCAAGATCCCTATGCTCGAGCATAGGGATCTTGAAGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010510.1-74s21c1
Sequence:CCGGAGCCCTCTCCATCAACTATAACTCGAGTTATAGTTGATGGAGAGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010510
IFNB1 MISSION shRNA Lentiviral Transduction Particles
interferon, beta 1, fibroblast
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010510.1-575s1c1
Sequence:CCGGTGTCAGTTGATGCCTCAGAATCTCGAGATTCTGAGGCATCAACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-423s1c1
Sequence:CCGGGCTCTCCACTTGAAGAGCTATCTCGAGATAGCTCTTCAAGTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-510s1c1
Sequence:CCGGGCAGAGATCTTCAGGAACTTTCTCGAGAAAGTTCCTGAAGATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-221s1c1
Sequence:CCGGGCAGAAGAGTTACACTGCCTTCTCGAGAAGGCAGTGTAACTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010510.1-104s1c1
Sequence:CCGGGCTCCAAGAAAGGACGAACATCTCGAGATGTTCGTCCTTTCTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010510.1-183s21c1
Sequence:CCGGGCGGACTTCAAGATCCCTATGCTCGAGCATAGGGATCTTGAAGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010510.1-74s21c1
Sequence:CCGGAGCCCTCTCCATCAACTATAACTCGAGTTATAGTTGATGGAGAGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002176
IFNB1 MISSION shRNA Bacterial Glycerol Stock
interferon, beta 1, fibroblast
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002176.1-607s1c1
Sequence:CCGGAGCATTCTTCAACCAGCAGATCTCGAGATCTGCTGGTTGAAGAATGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-501s1c1
Sequence:CCGGCAGAGTGGAAATCCTAAGGAACTCGAGTTCCTTAGGATTTCCACTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-66s1c1
Sequence:CCGGGAGCTACAACTTGCTTGGATTCTCGAGAATCCAAGCAAGTTGTAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-228s1c1
Sequence:CCGGCGCATTGACCATCTATGAGATCTCGAGATCTCATAGATGGTCAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-87s1c1
Sequence:CCGGCCTACAAAGAAGCAGCAATTTCTCGAGAAATTGCTGCTTCTTTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-404s21c1
Sequence:CCGGCTAATGTCTATCATCAGATAACTCGAGTTATCTGATGATAGACATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-253s21c1
Sequence:CCGGGACATCCCTGAGGAGATTAAGCTCGAGCTTAATCTCCTCAGGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-207s21c1
Sequence:CCGGATTGAATGGGAGGCTTGAATACTCGAGTATTCAAGCCTCCCATTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002176
IFNB1 MISSION shRNA shRNA Plasmid DNA
interferon, beta 1, fibroblast
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002176.1-607s1c1
Sequence:CCGGAGCATTCTTCAACCAGCAGATCTCGAGATCTGCTGGTTGAAGAATGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-501s1c1
Sequence:CCGGCAGAGTGGAAATCCTAAGGAACTCGAGTTCCTTAGGATTTCCACTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-66s1c1
Sequence:CCGGGAGCTACAACTTGCTTGGATTCTCGAGAATCCAAGCAAGTTGTAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-228s1c1
Sequence:CCGGCGCATTGACCATCTATGAGATCTCGAGATCTCATAGATGGTCAATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-87s1c1
Sequence:CCGGCCTACAAAGAAGCAGCAATTTCTCGAGAAATTGCTGCTTCTTTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-404s21c1
Sequence:CCGGCTAATGTCTATCATCAGATAACTCGAGTTATCTGATGATAGACATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-253s21c1
Sequence:CCGGGACATCCCTGAGGAGATTAAGCTCGAGCTTAATCTCCTCAGGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-207s21c1
Sequence:CCGGATTGAATGGGAGGCTTGAATACTCGAGTATTCAAGCCTCCCATTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002176
IFNB1 MISSION shRNA Lentiviral Transduction Particles
interferon, beta 1, fibroblast
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002176.1-607s1c1
Sequence:CCGGAGCATTCTTCAACCAGCAGATCTCGAGATCTGCTGGTTGAAGAATGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-501s1c1
Sequence:CCGGCAGAGTGGAAATCCTAAGGAACTCGAGTTCCTTAGGATTTCCACTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-66s1c1
Sequence:CCGGGAGCTACAACTTGCTTGGATTCTCGAGAATCCAAGCAAGTTGTAGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-228s1c1
Sequence:CCGGCGCATTGACCATCTATGAGATCTCGAGATCTCATAGATGGTCAATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002176.1-87s1c1
Sequence:CCGGCCTACAAAGAAGCAGCAATTTCTCGAGAAATTGCTGCTTCTTTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-404s21c1
Sequence:CCGGCTAATGTCTATCATCAGATAACTCGAGTTATCTGATGATAGACATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-253s21c1
Sequence:CCGGGACATCCCTGAGGAGATTAAGCTCGAGCTTAATCTCCTCAGGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002176.2-207s21c1
Sequence:CCGGATTGAATGGGAGGCTTGAATACTCGAGTATTCAAGCCTCCCATTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)