EMAIL THIS PAGE TO A FRIEND

IFNG

interferon, gamma

152 Gene Product Result for
Synonyms: IFG IFI
UniProtKB ID: P01579, B5BU88, Q53ZV4
Gene ID:
Human(3458) Summary: This gene encodes a member of the type II interferon family. The protein encoded is a soluble cytokine with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. Mutations in this gene are associated with aplastic anemia.[provided by RefSeq, Nov 2009]
Mouse(15978) interferon gamma
Rat(25712) interferon gamma
naked mole-rat(101700722) interferon, gamma
Goat(100860815) interferon, gamma
Domestic Rabbit(100008602) interferon, gamma
sheep(443396) interferon, gamma
chicken(396054) interferon, gamma
chicken(100529779) Interferon-gamma level
chicken(100529610) Interferon-gamma level
chicken(100529504) Interferon-gamma level
chicken(395914) Interferon-gamma level
chicken(100529778) Interferon-gamma level
chicken(100529652) Interferon-gamma level
cow(281237) interferon, gamma
Horse(100034181) interferon, gamma
domestic cat(493965) interferon, gamma
dog(403801) interferon gamma
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
I9016 Anti-Interferon-γ antibody produced in goat IgG fraction of antiserum human
neutralization, western blot pricing
I8659 Anti-Interferon-γ antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
I9141 Anti-Interferon-γ antibody produced in goat affinity isolated antibody, lyophilized powder mouse
neutralization, western blot pricing
I5027 Anti-Interferon-γ antibody produced in goat affinity isolated antibody, lyophilized powder rat, mouse
immunohistochemistry, neutralization, western blot pricing
SAB4700340 Monoclonal Anti-IFNG antibody produced in mouse clone G-23, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1402815 Monoclonal Anti-IFNG, (C-terminal) antibody produced in mouse clone 2D3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
I2908 Monoclonal Anti-Interferon-γ antibody produced in hamster clone H22, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunoprecipitation (IP), neutralization, western blot pricing
I5521 Monoclonal Anti-Interferon-γ antibody produced in mouse clone 25718, purified immunoglobulin, lyophilized powder human
immunocytochemistry, neutralization pricing
I1142 Monoclonal Anti-Interferon-γ antibody produced in rat clone 37895.11, purified immunoglobulin, lyophilized powder mouse
ELISA, neutralization, western blot pricing
F8648 Monoclonal Anti-Interferon-γ−Carboxyfluorescein antibody produced in mouse clone 25723.11, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P6972 Monoclonal Anti-Interferon-γ−R-Phycoerythrin antibody produced in mouse clone 25723, purified immunoglobulin, saline solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000619 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028351 MISSION® esiRNA esiRNA human IFNG (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MAB1152 Anti-Interferon-γ Antibody, clone RMMG-1 Anti-Interferon-γ Antibody, clone RMMG-1 is an antibody against Interferon-γ for use in ELISA, IP, WB, IH, NEUT. pricing
MABF151C Anti-mouse IFN gamma, APC, clone XMG1.2 Antibody This rat monoclonal Anti-mouse IFN gamma Antibody, APC, clone XMG1.2, Cat. No. MABF1515 is validated for use in Flow Cytometry, for the detection of IFN gamma. pricing
MABF151D Anti-mouse IFN gamma, FITC, clone XMG1.2 Antibody This rat monoclonal Anti-mouse IFN gamma Antibody, FITC, clone XMG1.2, Cat. No. MABF1517 is validated for use in Flow Cytometry, for the detection of IFN gamma. pricing
FCMAB243P Anti-mouse IFN gamma -PE Antibody, clone XMG1.2 Detect mouse IFN gamma using this Anti-mouse IFN gamma -PE Antibody, clone XMG1.2 validated for use in FC. pricing
MABF1519 Anti-mouse IFN gamma, PE-Cy7, clone XMG1.2 Antibody Anti-mouse IFN gamma, PE-Cy7, clone XMG1.2 Antibody is an antibody against mouse IFN gamma for use in Flow Cytometry. pricing
MABF1520 Anti-mouse IFN gamma, PE-Cy7, clone XMG1.2 Antibody Anti-mouse IFN gamma, PE-Cy7, clone XMG1.2 Antibody is an antibody against mouse IFN gamma for use in Flow Cytometry. pricing
MABF152A Anti-mouse IFN gamma, violetFluor™ 450, clone XMG1.2 Antibody Anti-mouse IFN gamma, violetFluor™ 450, clone XMG1.2 Antibody is an antibody against mouse IFN gamma for use in Flow Cytometry. pricing
IF002 Interferon-γ Protein, Recombinant human The Interferon-g protein (or IFN-gamma protein) is a lymphoid factor which possesses potent anti-viral activity. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000619 Rosetta Predictions human pricing
NM_138880 Rosetta Predictions rat pricing
NM_008337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214998 predicted 398
2 SASI_Hs01_00214999 predicted 246
3 SASI_Hs01_00215000 predicted 242
4 SASI_Hs01_00215001 predicted 257
5 SASI_Hs01_00215002 predicted 248
6 SASI_Hs01_00215004 predicted 973
7 SASI_Hs01_00215005 predicted 914
8 SASI_Hs01_00215006 predicted 945
9 SASI_Hs02_00302953 predicted 916
10 SASI_Hs02_00302954 predicted 974
11 SASI_Hs01_00214997 predicted 397
12 SASI_Hs01_00215003 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071987 predicted 282
2 SASI_Rn01_00071988 predicted 295
3 SASI_Rn01_00071989 predicted 290
4 SASI_Rn01_00071990 predicted 232
5 SASI_Rn01_00071992 predicted 236
6 SASI_Rn01_00071994 predicted 274
7 SASI_Rn01_00071995 predicted 286
8 SASI_Rn02_00268309 predicted 197
9 SASI_Rn01_00071996 predicted 228
10 SASI_Rn02_00268310 predicted 199
11 SASI_Rn01_00071991 predicted 297
12 SASI_Rn01_00071993 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105273 predicted 384
2 SASI_Mm01_00105275 predicted 586
3 SASI_Mm01_00105276 predicted 732
4 SASI_Mm01_00105277 predicted 604
5 SASI_Mm01_00105278 predicted 723
6 SASI_Mm02_00313671 predicted 795
7 SASI_Mm01_00105279 predicted 587
8 SASI_Mm01_00105280 predicted 398
9 SASI_Mm01_00105281 predicted 705
10 SASI_Mm01_00105282 predicted 332
11 SASI_Mm01_00105274 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008337
IFNG MISSION shRNA Bacterial Glycerol Stock
interferon, gamma
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008337.3-591s21c1
Sequence:CCGGGAGATTGTCCCAATAAGAATACTCGAGTATTCTTATTGGGACAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008337.1-913s1c1
Sequence:CCGGCCTTTACTTCACTGACCAATACTCGAGTATTGGTCAGTGAAGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-310s1c1
Sequence:CCGGGAGCCAGATTATCTCTTTCTACTCGAGTAGAAAGAGATAATCTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-385s1c1
Sequence:CCGGCGTCATTGAATCACACCTGATCTCGAGATCAGGTGTGATTCAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-307s1c1
Sequence:CCGGGCAGAGCCAGATTATCTCTTTCTCGAGAAAGAGATAATCTGGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-183s1c1
Sequence:CCGGCAGTCATTGAAAGCCTAGAAACTCGAGTTTCTAGGCTTTCAATGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008337.3-697s21c1
Sequence:CCGGCATCAACCAAAGAAGTATTTACTCGAGTAAATACTTCTTTGGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008337.3-335s21c1
Sequence:CCGGGACTCTTTGAAGTCTTGAAAGCTCGAGCTTTCAAGACTTCAAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008337
IFNG MISSION shRNA shRNA Plasmid DNA
interferon, gamma
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008337.3-591s21c1
Sequence:CCGGGAGATTGTCCCAATAAGAATACTCGAGTATTCTTATTGGGACAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008337.1-913s1c1
Sequence:CCGGCCTTTACTTCACTGACCAATACTCGAGTATTGGTCAGTGAAGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-310s1c1
Sequence:CCGGGAGCCAGATTATCTCTTTCTACTCGAGTAGAAAGAGATAATCTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-385s1c1
Sequence:CCGGCGTCATTGAATCACACCTGATCTCGAGATCAGGTGTGATTCAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-307s1c1
Sequence:CCGGGCAGAGCCAGATTATCTCTTTCTCGAGAAAGAGATAATCTGGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-183s1c1
Sequence:CCGGCAGTCATTGAAAGCCTAGAAACTCGAGTTTCTAGGCTTTCAATGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008337.3-697s21c1
Sequence:CCGGCATCAACCAAAGAAGTATTTACTCGAGTAAATACTTCTTTGGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008337.3-335s21c1
Sequence:CCGGGACTCTTTGAAGTCTTGAAAGCTCGAGCTTTCAAGACTTCAAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008337
IFNG MISSION shRNA Lentiviral Transduction Particles
interferon, gamma
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008337.3-591s21c1
Sequence:CCGGGAGATTGTCCCAATAAGAATACTCGAGTATTCTTATTGGGACAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008337.1-913s1c1
Sequence:CCGGCCTTTACTTCACTGACCAATACTCGAGTATTGGTCAGTGAAGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-310s1c1
Sequence:CCGGGAGCCAGATTATCTCTTTCTACTCGAGTAGAAAGAGATAATCTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-385s1c1
Sequence:CCGGCGTCATTGAATCACACCTGATCTCGAGATCAGGTGTGATTCAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-307s1c1
Sequence:CCGGGCAGAGCCAGATTATCTCTTTCTCGAGAAAGAGATAATCTGGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008337.1-183s1c1
Sequence:CCGGCAGTCATTGAAAGCCTAGAAACTCGAGTTTCTAGGCTTTCAATGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008337.3-697s21c1
Sequence:CCGGCATCAACCAAAGAAGTATTTACTCGAGTAAATACTTCTTTGGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008337.3-335s21c1
Sequence:CCGGGACTCTTTGAAGTCTTGAAAGCTCGAGCTTTCAAGACTTCAAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000619
IFNG MISSION shRNA Bacterial Glycerol Stock
interferon, gamma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-514s1c1
Sequence:CCGGCTCATCCAAGTGATGGCTGAACTCGAGTTCAGCCATCACTTGGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-581s1c1
Sequence:CCGGTGTTTCAAGGTCGAAGAGCATCTCGAGATGCTCTTCGACCTTGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-232s1c1
Sequence:CCGGCATTCAGATGTAGCGGATAATCTCGAGATTATCCGCTACATCTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-481s1c1
Sequence:CCGGGACTTGAATGTCCAACGCAAACTCGAGTTTGCGTTGGACATTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000619.2-629s21c1
Sequence:CCGGGGTTGTCCTGCCTGCAATATTCTCGAGAATATTGCAGGCAGGACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-312s1c1
Sequence:CCGGGCAGAGCCAAATTGTCTCCTTCTCGAGAAGGAGACAATTTGGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000619.2-958s21c1
Sequence:CCGGTATAAGTGAAGTGATACTATCCTCGAGGATAGTATCACTTCACTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000619.2-187s21c1
Sequence:CCGGTGTTACTGCCAGGACCCATATCTCGAGATATGGGTCCTGGCAGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000619
IFNG MISSION shRNA shRNA Plasmid DNA
interferon, gamma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-514s1c1
Sequence:CCGGCTCATCCAAGTGATGGCTGAACTCGAGTTCAGCCATCACTTGGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-581s1c1
Sequence:CCGGTGTTTCAAGGTCGAAGAGCATCTCGAGATGCTCTTCGACCTTGAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-232s1c1
Sequence:CCGGCATTCAGATGTAGCGGATAATCTCGAGATTATCCGCTACATCTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-481s1c1
Sequence:CCGGGACTTGAATGTCCAACGCAAACTCGAGTTTGCGTTGGACATTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000619.2-629s21c1
Sequence:CCGGGGTTGTCCTGCCTGCAATATTCTCGAGAATATTGCAGGCAGGACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-312s1c1
Sequence:CCGGGCAGAGCCAAATTGTCTCCTTCTCGAGAAGGAGACAATTTGGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000619.2-958s21c1
Sequence:CCGGTATAAGTGAAGTGATACTATCCTCGAGGATAGTATCACTTCACTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000619.2-187s21c1
Sequence:CCGGTGTTACTGCCAGGACCCATATCTCGAGATATGGGTCCTGGCAGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000619
IFNG MISSION shRNA Lentiviral Transduction Particles
interferon, gamma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-514s1c1
Sequence:CCGGCTCATCCAAGTGATGGCTGAACTCGAGTTCAGCCATCACTTGGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-581s1c1
Sequence:CCGGTGTTTCAAGGTCGAAGAGCATCTCGAGATGCTCTTCGACCTTGAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-232s1c1
Sequence:CCGGCATTCAGATGTAGCGGATAATCTCGAGATTATCCGCTACATCTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-481s1c1
Sequence:CCGGGACTTGAATGTCCAACGCAAACTCGAGTTTGCGTTGGACATTCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000619.2-629s21c1
Sequence:CCGGGGTTGTCCTGCCTGCAATATTCTCGAGAATATTGCAGGCAGGACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000619.1-312s1c1
Sequence:CCGGGCAGAGCCAAATTGTCTCCTTCTCGAGAAGGAGACAATTTGGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000619.2-958s21c1
Sequence:CCGGTATAAGTGAAGTGATACTATCCTCGAGGATAGTATCACTTCACTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000619.2-187s21c1
Sequence:CCGGTGTTACTGCCAGGACCCATATCTCGAGATATGGGTCCTGGCAGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)