EMAIL THIS PAGE TO A FRIEND

IFNGR1

interferon gamma receptor 1

70 Gene Product Result for
Synonyms: CD119 IFNGR
UniProtKB ID: P15260, E1P587, Q53Y96
Gene ID:
Human(3459) Summary: This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
Mouse(15979) interferon gamma receptor 1
Rat(116465) interferon gamma receptor 1
chicken(421685) interferon gamma receptor 1
domestic cat(101086811) interferon gamma receptor 1
cow(508619) interferon gamma receptor 1
dog(476216) interferon gamma receptor 1
sheep(101112907) interferon gamma receptor 1
domestic guinea pig(100724091) interferon gamma receptor 1
naked mole-rat(101709169) interferon gamma receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000416 Rosetta Predictions human pricing
NM_053783 Rosetta Predictions rat pricing
NM_010511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146066 predicted 517
2 SASI_Hs01_00146067 predicted 1133
3 SASI_Hs01_00146069 predicted 595
4 SASI_Hs01_00146070 predicted 1358
5 SASI_Hs01_00146071 predicted 1212
6 SASI_Hs02_00302512 predicted 600
7 SASI_Hs01_00146072 predicted 1492
8 SASI_Hs01_00146073 predicted 1521
9 SASI_Hs02_00302513 predicted 1358
10 SASI_Hs02_00302514 predicted 1126
11 SASI_Hs01_00146068 predicted 273
12 SASI_Hs01_00146074 predicted 1313
13 SASI_Hs01_00146075 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100926 predicted 1283
2 SASI_Rn01_00100928 predicted 1416
3 SASI_Rn01_00100929 predicted 309
4 SASI_Rn01_00100931 predicted 907
5 SASI_Rn02_00266589 predicted 562
6 SASI_Rn01_00100932 predicted 1288
7 SASI_Rn01_00100933 predicted 294
8 SASI_Rn01_00100934 predicted 385
9 SASI_Rn01_00100935 predicted 1180
10 SASI_Rn02_00266590 predicted 484
11 SASI_Rn01_00100927 predicted 623
12 SASI_Rn01_00100930 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169923 predicted 254
2 SASI_Mm01_00169924 predicted 1629
3 SASI_Mm01_00169925 predicted 770
4 SASI_Mm01_00169926 predicted 385
5 SASI_Mm02_00318774 predicted 1371
6 SASI_Mm01_00169928 predicted 498
7 SASI_Mm01_00169929 predicted 730
8 SASI_Mm01_00169930 predicted 437
9 SASI_Mm01_00169931 predicted 1294
10 SASI_Mm01_00169932 predicted 940
11 SASI_Mm01_00169927 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010511
VALIDATED
IFNGR1 MISSION shRNA Bacterial Glycerol Stock
interferon gamma receptor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010511.2-1659s21c3
Sequence:CCGGCCACATAGAATATCAGACTTACTCGAGTAAGTCTGATATTCTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-907s21c1
Sequence:CCGGTTGCTCCTCTTACCGTCTTTACTCGAGTAAAGACGGTAAGAGGAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-568s21c1
Sequence:CCGGAGCTCTCCGTCCTCGTATTTCCTCGAGGAAATACGAGGACGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-444s21c2
Sequence:CCGGGCCAGAGTTAAAGCTAAGGTTCTCGAGAACCTTAGCTTTAACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-646s21c1
Sequence:CCGGCCTGTTACACATTCGACTATACTCGAGTATAGTCGAATGTGTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-1632s1c1
Sequence:CCGGCCACATAGAATATCAGACTTACTCGAGTAAGTCTGATATTCTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010511.1-1430s1c1
Sequence:CCGGCGGTTATGACAAACCGCACATCTCGAGATGTGCGGTTTGTCATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-619s1c1
Sequence:CCGGCCTGTTACACATTCGACTATACTCGAGTATAGTCGAATGTGTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-745s1c1
Sequence:CCGGCCACACTGGATTCCAGATATTCTCGAGAATATCTGGAATCCAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-417s1c1
Sequence:CCGGGCCAGAGTTAAAGCTAAGGTTCTCGAGAACCTTAGCTTTAACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010511
VALIDATED
IFNGR1 MISSION shRNA shRNA Plasmid DNA
interferon gamma receptor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010511.2-1659s21c3
Sequence:CCGGCCACATAGAATATCAGACTTACTCGAGTAAGTCTGATATTCTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-907s21c1
Sequence:CCGGTTGCTCCTCTTACCGTCTTTACTCGAGTAAAGACGGTAAGAGGAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-568s21c1
Sequence:CCGGAGCTCTCCGTCCTCGTATTTCCTCGAGGAAATACGAGGACGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-444s21c2
Sequence:CCGGGCCAGAGTTAAAGCTAAGGTTCTCGAGAACCTTAGCTTTAACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-646s21c1
Sequence:CCGGCCTGTTACACATTCGACTATACTCGAGTATAGTCGAATGTGTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-1632s1c1
Sequence:CCGGCCACATAGAATATCAGACTTACTCGAGTAAGTCTGATATTCTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010511.1-1430s1c1
Sequence:CCGGCGGTTATGACAAACCGCACATCTCGAGATGTGCGGTTTGTCATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-619s1c1
Sequence:CCGGCCTGTTACACATTCGACTATACTCGAGTATAGTCGAATGTGTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-745s1c1
Sequence:CCGGCCACACTGGATTCCAGATATTCTCGAGAATATCTGGAATCCAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-417s1c1
Sequence:CCGGGCCAGAGTTAAAGCTAAGGTTCTCGAGAACCTTAGCTTTAACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010511
VALIDATED
IFNGR1 MISSION shRNA Lentiviral Transduction Particles
interferon gamma receptor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010511.2-1659s21c3
Sequence:CCGGCCACATAGAATATCAGACTTACTCGAGTAAGTCTGATATTCTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-907s21c1
Sequence:CCGGTTGCTCCTCTTACCGTCTTTACTCGAGTAAAGACGGTAAGAGGAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-568s21c1
Sequence:CCGGAGCTCTCCGTCCTCGTATTTCCTCGAGGAAATACGAGGACGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-444s21c2
Sequence:CCGGGCCAGAGTTAAAGCTAAGGTTCTCGAGAACCTTAGCTTTAACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010511.2-646s21c1
Sequence:CCGGCCTGTTACACATTCGACTATACTCGAGTATAGTCGAATGTGTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-1632s1c1
Sequence:CCGGCCACATAGAATATCAGACTTACTCGAGTAAGTCTGATATTCTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010511.1-1430s1c1
Sequence:CCGGCGGTTATGACAAACCGCACATCTCGAGATGTGCGGTTTGTCATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-619s1c1
Sequence:CCGGCCTGTTACACATTCGACTATACTCGAGTATAGTCGAATGTGTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-745s1c1
Sequence:CCGGCCACACTGGATTCCAGATATTCTCGAGAATATCTGGAATCCAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010511.1-417s1c1
Sequence:CCGGGCCAGAGTTAAAGCTAAGGTTCTCGAGAACCTTAGCTTTAACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000416
VALIDATED
IFNGR1 MISSION shRNA Bacterial Glycerol Stock
interferon gamma receptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-567s21c1
Sequence:CCGGACGAGCAGGAAGTCGATTATGCTCGAGCATAATCGACTTCCTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-851s21c1
Sequence:CCGGCCAGTTGTTGCTGCTTTACTACTCGAGTAGTAAAGCAGCAACAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000416.2-640s21c1
Sequence:CCGGCGGAAGTGAGATCCAGTATAACTCGAGTTATACTGGATCTCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-185s21c1
Sequence:CCGGTCAGTGCCTACACCAACTAATCTCGAGATTAGTTGGTGTAGGCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000416.2-226s21c1
Sequence:CCGGCATGAACCCTATCGTATATTGCTCGAGCAATATACGATAGGGTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-377s1c1
Sequence:CCGGGCCTATGCAAAGTCAGAAGAACTCGAGTTCTTCTGACTTTGCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-791s1c1
Sequence:CCGGCCAGTTGTTGCTGCTTTACTACTCGAGTAGTAAAGCAGCAACAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000416.1-530s1c1
Sequence:CCGGCCCGAAACTACCTGTTACATTCTCGAGAATGTAACAGGTAGTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-580s1c1
Sequence:CCGGCGGAAGTGAGATCCAGTATAACTCGAGTTATACTGGATCTCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-1398s1c1
Sequence:CCGGCCACCTCCTTTGGTTATGATACTCGAGTATCATAACCAAAGGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000416
VALIDATED
IFNGR1 MISSION shRNA shRNA Plasmid DNA
interferon gamma receptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-567s21c1
Sequence:CCGGACGAGCAGGAAGTCGATTATGCTCGAGCATAATCGACTTCCTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-851s21c1
Sequence:CCGGCCAGTTGTTGCTGCTTTACTACTCGAGTAGTAAAGCAGCAACAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000416.2-640s21c1
Sequence:CCGGCGGAAGTGAGATCCAGTATAACTCGAGTTATACTGGATCTCACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-185s21c1
Sequence:CCGGTCAGTGCCTACACCAACTAATCTCGAGATTAGTTGGTGTAGGCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000416.2-226s21c1
Sequence:CCGGCATGAACCCTATCGTATATTGCTCGAGCAATATACGATAGGGTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-377s1c1
Sequence:CCGGGCCTATGCAAAGTCAGAAGAACTCGAGTTCTTCTGACTTTGCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-791s1c1
Sequence:CCGGCCAGTTGTTGCTGCTTTACTACTCGAGTAGTAAAGCAGCAACAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000416.1-530s1c1
Sequence:CCGGCCCGAAACTACCTGTTACATTCTCGAGAATGTAACAGGTAGTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-580s1c1
Sequence:CCGGCGGAAGTGAGATCCAGTATAACTCGAGTTATACTGGATCTCACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-1398s1c1
Sequence:CCGGCCACCTCCTTTGGTTATGATACTCGAGTATCATAACCAAAGGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000416
VALIDATED
IFNGR1 MISSION shRNA Lentiviral Transduction Particles
interferon gamma receptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-567s21c1
Sequence:CCGGACGAGCAGGAAGTCGATTATGCTCGAGCATAATCGACTTCCTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-851s21c1
Sequence:CCGGCCAGTTGTTGCTGCTTTACTACTCGAGTAGTAAAGCAGCAACAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000416.2-640s21c1
Sequence:CCGGCGGAAGTGAGATCCAGTATAACTCGAGTTATACTGGATCTCACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000416.2-185s21c1
Sequence:CCGGTCAGTGCCTACACCAACTAATCTCGAGATTAGTTGGTGTAGGCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000416.2-226s21c1
Sequence:CCGGCATGAACCCTATCGTATATTGCTCGAGCAATATACGATAGGGTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-377s1c1
Sequence:CCGGGCCTATGCAAAGTCAGAAGAACTCGAGTTCTTCTGACTTTGCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-791s1c1
Sequence:CCGGCCAGTTGTTGCTGCTTTACTACTCGAGTAGTAAAGCAGCAACAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000416.1-530s1c1
Sequence:CCGGCCCGAAACTACCTGTTACATTCTCGAGAATGTAACAGGTAGTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-580s1c1
Sequence:CCGGCGGAAGTGAGATCCAGTATAACTCGAGTTATACTGGATCTCACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000416.1-1398s1c1
Sequence:CCGGCCACCTCCTTTGGTTATGATACTCGAGTATCATAACCAAAGGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)