EMAIL THIS PAGE TO A FRIEND

IFNGR2

interferon gamma receptor 2 (interferon gamma transducer 1)

94 Gene Product Result for
Synonyms: AF-1 IFGR2 IFNGT1
UniProtKB ID: P38484, Q9BTL5
Gene ID:
Human(3460) Summary: This gene (IFNGR2) encodes the non-ligand-binding beta chain of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. Defects in IFNGR2 are a cause of mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. MSMD is a genetically heterogeneous disease with autosomal recessive, autosomal dominant or X-linked inheritance. [provided by RefSeq, Jul 2008]
Mouse(15980) interferon gamma receptor 2
Rat(360697) interferon gamma receptor 2
domestic guinea pig(100714935) interferon gamma receptor 2 (interferon gamma transducer 1)
naked mole-rat(101724858) interferon gamma receptor 2 (interferon gamma transducer 1)
sheep(101122484) interferon gamma receptor 2 (interferon gamma transducer 1)
chicken(418502) interferon gamma receptor 2 (interferon gamma transducer 1)
cow(514889) interferon gamma receptor 2 (interferon gamma transducer 1)
domestic cat(101092286) interferon gamma receptor 2 (interferon gamma transducer 1)
dog(487739) interferon gamma receptor 2 (interferon gamma transducer 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005534 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005534 Rosetta Predictions human pricing
NM_001108313 Rosetta Predictions rat pricing
NM_008338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231439 predicted 1533
2 SASI_Hs01_00231441 predicted 1330
3 SASI_Hs01_00231442 predicted 1513
4 SASI_Hs01_00231443 predicted 1144
5 SASI_Hs01_00231445 predicted 1040
6 SASI_Hs01_00231446 predicted 1542
7 SASI_Hs01_00231447 predicted 1337
8 SASI_Hs01_00231448 predicted 1273
9 SASI_Hs02_00339769 predicted 1310
10 SASI_Hs02_00339770 predicted 1266
11 SASI_Hs01_00231440 predicted 1459
12 SASI_Hs01_00231444 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237429 predicted 693
2 SASI_Rn02_00237430 predicted 822
3 SASI_Rn02_00237431 predicted 668
4 SASI_Rn02_00237432 predicted 473
5 SASI_Rn02_00237433 predicted 545
6 SASI_Rn02_00237434 predicted 943
7 SASI_Rn02_00237435 predicted 349
8 SASI_Rn02_00237436 predicted 913
9 SASI_Rn02_00237437 predicted 659
10 SASI_Rn02_00237438 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154983 predicted 241
2 SASI_Mm01_00154984 predicted 319
3 SASI_Mm01_00154985 predicted 458
4 SASI_Mm01_00154986 predicted 947
5 SASI_Mm01_00154987 predicted 938
6 SASI_Mm01_00154988 predicted 451
7 SASI_Mm02_00313672 predicted 923
8 SASI_Mm01_00154989 predicted 248
9 SASI_Mm01_00154990 predicted 965
10 SASI_Mm01_00154991 predicted 935
11 SASI_Mm01_00154992 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008338
VALIDATED
IFNGR2 MISSION shRNA Bacterial Glycerol Stock
interferon gamma receptor 2 (interferon gamma transducer 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-916s1c1
Sequence:CCGGCCGGAACAAATCGAAGAGTATCTCGAGATACTCTTCGATTTGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-255s1c1
Sequence:CCGGCCAGGTGGAATATAGCTTCATCTCGAGATGAAGCTATATTCCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-438s1c1
Sequence:CCGGGCTGGAGCCATTTCAACACTACTCGAGTAGTGTTGAAATGGCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-743s1c1
Sequence:CCGGGCAATGTATCCTGTCACGAAACTCGAGTTTCGTGACAGGATACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008338.2-663s1c1
Sequence:CCGGGCCATACAGAGTATATTGTTTCTCGAGAAACAATATACTCTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008338
VALIDATED
IFNGR2 MISSION shRNA shRNA Plasmid DNA
interferon gamma receptor 2 (interferon gamma transducer 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-916s1c1
Sequence:CCGGCCGGAACAAATCGAAGAGTATCTCGAGATACTCTTCGATTTGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-255s1c1
Sequence:CCGGCCAGGTGGAATATAGCTTCATCTCGAGATGAAGCTATATTCCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-438s1c1
Sequence:CCGGGCTGGAGCCATTTCAACACTACTCGAGTAGTGTTGAAATGGCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-743s1c1
Sequence:CCGGGCAATGTATCCTGTCACGAAACTCGAGTTTCGTGACAGGATACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008338.2-663s1c1
Sequence:CCGGGCCATACAGAGTATATTGTTTCTCGAGAAACAATATACTCTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008338
VALIDATED
IFNGR2 MISSION shRNA Lentiviral Transduction Particles
interferon gamma receptor 2 (interferon gamma transducer 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-916s1c1
Sequence:CCGGCCGGAACAAATCGAAGAGTATCTCGAGATACTCTTCGATTTGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-255s1c1
Sequence:CCGGCCAGGTGGAATATAGCTTCATCTCGAGATGAAGCTATATTCCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-438s1c1
Sequence:CCGGGCTGGAGCCATTTCAACACTACTCGAGTAGTGTTGAAATGGCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008338.2-743s1c1
Sequence:CCGGGCAATGTATCCTGTCACGAAACTCGAGTTTCGTGACAGGATACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008338.2-663s1c1
Sequence:CCGGGCCATACAGAGTATATTGTTTCTCGAGAAACAATATACTCTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005534
VALIDATED
IFNGR2 MISSION shRNA Bacterial Glycerol Stock
interferon gamma receptor 2 (interferon gamma transducer 1)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-2014s1c1
Sequence:CCGGCGTCGTCTTGACTTTGGCAAACTCGAGTTTGCCAAAGTCAAGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1458s1c1
Sequence:CCGGCCTGAAATATAGAGGCCTGATCTCGAGATCAGGCCTCTATATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005534.2-846s1c1
Sequence:CCGGGTTTAAATACACCGACAGTAACTCGAGTTACTGTCGGTGTATTTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1258s1c1
Sequence:CCGGCCCTCCAGAGTGTACTGTTTACTCGAGTAAACAGTACACTCTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1337s1c1
Sequence:CCGGGCAACATATCTTGCTACGAAACTCGAGTTTCGTAGCAAGATATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-955s21c1
Sequence:CCGGGCAGGCTTCCCAATGGATTTCCTCGAGGAAATCCATTGGGAAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1235s21c1
Sequence:CCGGCCATTTCATTGGATAACTTAACTCGAGTTAAGTTATCCAATGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1597s21c1
Sequence:CCGGTGGGACTCTGTGTCCATTATCCTCGAGGATAATGGACACAGAGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-2014s21c1
Sequence:CCGGCGTCGTCTTGACTTTGGCAAACTCGAGTTTGCCAAAGTCAAGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005534.3-1258s21c1
Sequence:CCGGCCCTCCAGAGTGTACTGTTTACTCGAGTAAACAGTACACTCTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1015s21c1
Sequence:CCGGCATTCTGCCTGGGTGACAATGCTCGAGCATTGTCACCCAGGCAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005534
VALIDATED
IFNGR2 MISSION shRNA shRNA Plasmid DNA
interferon gamma receptor 2 (interferon gamma transducer 1)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-2014s1c1
Sequence:CCGGCGTCGTCTTGACTTTGGCAAACTCGAGTTTGCCAAAGTCAAGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1458s1c1
Sequence:CCGGCCTGAAATATAGAGGCCTGATCTCGAGATCAGGCCTCTATATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005534.2-846s1c1
Sequence:CCGGGTTTAAATACACCGACAGTAACTCGAGTTACTGTCGGTGTATTTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1258s1c1
Sequence:CCGGCCCTCCAGAGTGTACTGTTTACTCGAGTAAACAGTACACTCTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1337s1c1
Sequence:CCGGGCAACATATCTTGCTACGAAACTCGAGTTTCGTAGCAAGATATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-955s21c1
Sequence:CCGGGCAGGCTTCCCAATGGATTTCCTCGAGGAAATCCATTGGGAAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1235s21c1
Sequence:CCGGCCATTTCATTGGATAACTTAACTCGAGTTAAGTTATCCAATGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1597s21c1
Sequence:CCGGTGGGACTCTGTGTCCATTATCCTCGAGGATAATGGACACAGAGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-2014s21c1
Sequence:CCGGCGTCGTCTTGACTTTGGCAAACTCGAGTTTGCCAAAGTCAAGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005534.3-1258s21c1
Sequence:CCGGCCCTCCAGAGTGTACTGTTTACTCGAGTAAACAGTACACTCTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1015s21c1
Sequence:CCGGCATTCTGCCTGGGTGACAATGCTCGAGCATTGTCACCCAGGCAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005534
VALIDATED
IFNGR2 MISSION shRNA Lentiviral Transduction Particles
interferon gamma receptor 2 (interferon gamma transducer 1)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-2014s1c1
Sequence:CCGGCGTCGTCTTGACTTTGGCAAACTCGAGTTTGCCAAAGTCAAGACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1458s1c1
Sequence:CCGGCCTGAAATATAGAGGCCTGATCTCGAGATCAGGCCTCTATATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005534.2-846s1c1
Sequence:CCGGGTTTAAATACACCGACAGTAACTCGAGTTACTGTCGGTGTATTTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1258s1c1
Sequence:CCGGCCCTCCAGAGTGTACTGTTTACTCGAGTAAACAGTACACTCTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005534.2-1337s1c1
Sequence:CCGGGCAACATATCTTGCTACGAAACTCGAGTTTCGTAGCAAGATATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-955s21c1
Sequence:CCGGGCAGGCTTCCCAATGGATTTCCTCGAGGAAATCCATTGGGAAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1235s21c1
Sequence:CCGGCCATTTCATTGGATAACTTAACTCGAGTTAAGTTATCCAATGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1597s21c1
Sequence:CCGGTGGGACTCTGTGTCCATTATCCTCGAGGATAATGGACACAGAGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-2014s21c1
Sequence:CCGGCGTCGTCTTGACTTTGGCAAACTCGAGTTTGCCAAAGTCAAGACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005534.3-1258s21c1
Sequence:CCGGCCCTCCAGAGTGTACTGTTTACTCGAGTAAACAGTACACTCTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005534.3-1015s21c1
Sequence:CCGGCATTCTGCCTGGGTGACAATGCTCGAGCATTGTCACCCAGGCAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)