EMAIL THIS PAGE TO A FRIEND

IFNK

interferon, kappa

62 Gene Product Result for
Synonyms: IFNT1 INFE1 RP11-27J8.1
UniProtKB ID: Q9P0W0, Q5T166
Gene ID:
Human(56832) Summary: This gene encodes a member of the type I interferon family. Type I interferons are a group of related glycoproteins that play an important role in host defenses against viral infections. This protein is expressed in keratinocytes and the gene is found on chromosome 9, adjacent to the type I interferon cluster. [provided by RefSeq, Jul 2008]
Mouse(387510) interferon kappa
Rat(313152) interferon kappa
dog(481568) interferon, kappa
cow(100138192) interferon, kappa
domestic cat(101092553) interferon, kappa
sheep(101111520) interferon, kappa
naked mole-rat(101706424) interferon, kappa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020124 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063701 MISSION® esiRNA esiRNA targeting mouse Ifnk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020124 Rosetta Predictions human pricing
NM_001107925 Rosetta Predictions rat pricing
NM_199157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186607 predicted 670
2 SASI_Hs02_00352986 predicted 729
3 SASI_Hs01_00186609 predicted 909
4 SASI_Hs01_00186610 predicted 706
5 SASI_Hs01_00186612 predicted 667
6 SASI_Hs01_00186613 predicted 777
7 SASI_Hs01_00186614 predicted 832
8 SASI_Hs01_00186615 predicted 787
9 SASI_Hs01_00186616 predicted 832
10 SASI_Hs02_00352987 predicted 780
11 SASI_Hs01_00186608 predicted 857
12 SASI_Hs01_00186611 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233635 predicted 527
2 SASI_Rn02_00233636 predicted 597
3 SASI_Rn02_00233637 predicted 512
4 SASI_Rn02_00233638 predicted 341
5 SASI_Rn02_00233639 predicted 294
6 SASI_Rn02_00233640 predicted 557
7 SASI_Rn02_00233641 predicted 211
8 SASI_Rn02_00233642 predicted 426
9 SASI_Rn02_00233643 predicted 490
10 SASI_Rn02_00233644 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036657 predicted 263
2 SASI_Mm01_00036658 predicted 309
3 SASI_Mm01_00036659 predicted 593
4 SASI_Mm01_00036660 predicted 207
5 SASI_Mm01_00036661 predicted 285
6 SASI_Mm01_00036662 predicted 224
7 SASI_Mm01_00036664 predicted 400
8 SASI_Mm01_00036665 predicted 225
9 SASI_Mm01_00036666 predicted 440
10 SASI_Mm02_00351378 predicted 447
11 SASI_Mm01_00036663 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020124
IFNK MISSION shRNA Bacterial Glycerol Stock
interferon, kappa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020124.2-316s21c1
Sequence:CCGGTCAGCCAACACACCTTCAAATCTCGAGATTTGAAGGTGTGTTGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020124.2-678s21c1
Sequence:CCGGGAGATTGTGGCTACGCAAATGCTCGAGCATTTGCGTAGCCACAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020124.2-790s21c1
Sequence:CCGGCTGTTCAGATTCAAGATTATTCTCGAGAATAATCTTGAATCTGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-251s1c1
Sequence:CCGGCCAACCTATGAAGAGGGACATCTCGAGATGTCCCTCTTCATAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-178s1c1
Sequence:CCGGGCAATTCATTTCCTGTAGAATCTCGAGATTCTACAGGAAATGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-625s1c1
Sequence:CCGGCAGCTCTATTCAGGAGGAAATCTCGAGATTTCCTCCTGAATAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-279s1c1
Sequence:CCGGGCCTTCTATGAAATGTCCCTACTCGAGTAGGGACATTTCATAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-62s1c1
Sequence:CCGGGCTTGAGATCCTTATGGGTATCTCGAGATACCCATAAGGATCTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020124
IFNK MISSION shRNA shRNA Plasmid DNA
interferon, kappa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020124.2-316s21c1
Sequence:CCGGTCAGCCAACACACCTTCAAATCTCGAGATTTGAAGGTGTGTTGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020124.2-678s21c1
Sequence:CCGGGAGATTGTGGCTACGCAAATGCTCGAGCATTTGCGTAGCCACAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020124.2-790s21c1
Sequence:CCGGCTGTTCAGATTCAAGATTATTCTCGAGAATAATCTTGAATCTGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-251s1c1
Sequence:CCGGCCAACCTATGAAGAGGGACATCTCGAGATGTCCCTCTTCATAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-178s1c1
Sequence:CCGGGCAATTCATTTCCTGTAGAATCTCGAGATTCTACAGGAAATGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-625s1c1
Sequence:CCGGCAGCTCTATTCAGGAGGAAATCTCGAGATTTCCTCCTGAATAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-279s1c1
Sequence:CCGGGCCTTCTATGAAATGTCCCTACTCGAGTAGGGACATTTCATAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-62s1c1
Sequence:CCGGGCTTGAGATCCTTATGGGTATCTCGAGATACCCATAAGGATCTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020124
IFNK MISSION shRNA Lentiviral Transduction Particles
interferon, kappa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020124.2-316s21c1
Sequence:CCGGTCAGCCAACACACCTTCAAATCTCGAGATTTGAAGGTGTGTTGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020124.2-678s21c1
Sequence:CCGGGAGATTGTGGCTACGCAAATGCTCGAGCATTTGCGTAGCCACAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020124.2-790s21c1
Sequence:CCGGCTGTTCAGATTCAAGATTATTCTCGAGAATAATCTTGAATCTGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-251s1c1
Sequence:CCGGCCAACCTATGAAGAGGGACATCTCGAGATGTCCCTCTTCATAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-178s1c1
Sequence:CCGGGCAATTCATTTCCTGTAGAATCTCGAGATTCTACAGGAAATGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-625s1c1
Sequence:CCGGCAGCTCTATTCAGGAGGAAATCTCGAGATTTCCTCCTGAATAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-279s1c1
Sequence:CCGGGCCTTCTATGAAATGTCCCTACTCGAGTAGGGACATTTCATAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020124.1-62s1c1
Sequence:CCGGGCTTGAGATCCTTATGGGTATCTCGAGATACCCATAAGGATCTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199157
IFNK MISSION shRNA Bacterial Glycerol Stock
interferon, kappa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-428s1c1
Sequence:CCGGTGGGCAAGTATTTCTTCAGAACTCGAGTTCTGAAGAAATACTTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-250s1c1
Sequence:CCGGGCACTAACTATCTTCAATCTTCTCGAGAAGATTGAAGATAGTTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-189s1c1
Sequence:CCGGGCCATACATCCAGCATATGAACTCGAGTTCATATGCTGGATGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-57s1c1
Sequence:CCGGCCAATCTCTGAACTGTGTTTACTCGAGTAAACACAGTTCAGAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-355s1c1
Sequence:CCGGTGCTTCATGGACGAGGAGAAACTCGAGTTTCTCCTCGTCCATGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199157
IFNK MISSION shRNA shRNA Plasmid DNA
interferon, kappa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-428s1c1
Sequence:CCGGTGGGCAAGTATTTCTTCAGAACTCGAGTTCTGAAGAAATACTTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-250s1c1
Sequence:CCGGGCACTAACTATCTTCAATCTTCTCGAGAAGATTGAAGATAGTTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-189s1c1
Sequence:CCGGGCCATACATCCAGCATATGAACTCGAGTTCATATGCTGGATGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-57s1c1
Sequence:CCGGCCAATCTCTGAACTGTGTTTACTCGAGTAAACACAGTTCAGAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-355s1c1
Sequence:CCGGTGCTTCATGGACGAGGAGAAACTCGAGTTTCTCCTCGTCCATGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199157
IFNK MISSION shRNA Lentiviral Transduction Particles
interferon, kappa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-428s1c1
Sequence:CCGGTGGGCAAGTATTTCTTCAGAACTCGAGTTCTGAAGAAATACTTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-250s1c1
Sequence:CCGGGCACTAACTATCTTCAATCTTCTCGAGAAGATTGAAGATAGTTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-189s1c1
Sequence:CCGGGCCATACATCCAGCATATGAACTCGAGTTCATATGCTGGATGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-57s1c1
Sequence:CCGGCCAATCTCTGAACTGTGTTTACTCGAGTAAACACAGTTCAGAGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199157.1-355s1c1
Sequence:CCGGTGCTTCATGGACGAGGAGAAACTCGAGTTTCTCCTCGTCCATGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)